Open Access
Issue
Parasite
Volume 30, 2023
Article Number 30
Number of page(s) 26
DOI https://doi.org/10.1051/parasite/2023032
Published online 17 August 2023

© E. Řehulková et al., published by EDP Sciences, 2023

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

The Cypriniformes are the most diverse clade of primary freshwater fishes [45], with more than 4700 valid species [85]. Recently, four main suborders (lineages) of this monophyletic group (i.e., Catostomoidei, Cobitoidei, Cyprinoidei and Gyrinocheiloidei) have been proposed, with the Cyprinoidei containing multiple families including species previously classified in the Cyprinidae sensu lato [77, 83, 84]. The natural distribution range of the Cyprinoidei covers Eurasia, Africa and North America; however, out of a total of 12 families (including Cyprinidae sensu stricto), the Leuciscidae are the only one that is native to North America. The Catostomoidei (suckers) exhibit a Holarctic distribution, with their greatest diversity occurring in North America and only a single species present in Asia. The Cobitoidei (loaches) occur throughout Eurasia and northern Africa, and the Gyrinocheiloidei (algae eaters) are restricted to Southeast Asia [28]. Their great diversity and wide geographical distribution combined with our increasing knowledge of their phylogenetic relationships make cypriniforms attractive for studying ecological and evolutionary patterns and processes related to their closely associated parasites, such as highly host-specific monogeneans [35, 81, 82].

Monogeneans, a group of mainly ectoparasitic flatworms (Platyhelminthes) commonly found on the skin, fins, and gills of fishes, are among the most host-specific parasites (e.g., [62, 87]). These flatworms, having monoxenous life cycles, are highly diverse both in terms of species richness (currently, 5522 species are known; [29]) and morphology (i.e., they exhibit great morphological variety in the hard parts of the attachment and reproductive organs; [62]). Due to close evolutionary relationships with their fish hosts, monogeneans are generally considered useful biological tags for providing insights into their host’s taxonomy, phylogeny, and biogeography [7, 63]. There is no doubt that the basis for addressing ecological and evolutionary questions on parasites, including their host specificity and host-parasite coevolutionary interactions, is the correct identification of the studied species [27]. Parasite (as well as its host) misidentification, low taxonomic resolution (when, instead of species identification, only identification at the genus or family level is provided), and the occurrence of cryptic species are definite obstacles to resolving such questions [58, 64].

Cypriniforms are known to harbor gill-specific monogeneans of Dactylogyrus Diesing, 1850 (Dactylogyridae), one of the most speciose genera of helminths, with more than 900 nominal species [30]. The biogeography of Dactylogyrus spp. is undoubtedly closely related to the natural distribution of their cypriniform hosts, but records of these parasites vary widely in different regions of the world due to different levels of sampling efforts [30, 41]. Up to now, a total of 140 native species of cypriniforms have been reported as hosts of 224 species of monogeneans in North America [19, 20, 41, 47]. The majority of host species (i.e., 110 spp.) belong to the Leuciscidae (Cyprinoidei) [20, 41], the largest freshwater fish clade in North America, including more than 310 species [28]. The remaining host records belong to the Catostomoidei, with 75 species currently recognized [1]. As Dactylogyrus is a highly diversified genus with almost exclusive host specificity to fishes of the Cyprinoidei [30], it is not surprising that more than half of the monogenean species (i.e., 132 spp.; [19, 20, 41]) hitherto recorded on native North American cypriniforms belong to this genus.

The sclerotized structures of the attachment organ (i.e., the haptor) and distal parts of the reproductive system [i.e., the male copulatory organ (MCO) and vagina] play a major role in the description, delimitation, and discrimination of Dactylogyrus spp. However, many earlier taxonomic works on these parasites in North America are based on schematic illustrations of these taxonomically important structures, which probably gave rise to telescopic descriptions and poor differential diagnoses, resulting in many errors and several synonyms (e.g., [18, 39, 52]).

In 2018, a survey was initiated to investigate the morphological and molecular diversity of monogeneans parasitizing native North American cypriniforms in order to obtain reliable data for an analysis of their phylogenetic relationships and evolutionary history. A total of 28 species of cypriniform fishes from four states in the United States (i.e., Arkansas, Mississippi, New York, and Wisconsin) were examined. Besides other representatives of monogeneans, a total of 32 species of Dactylogyrus from the gills of 18 cypriniform host species were collected and morphologically recognized. Phylogenetic analyses based on concatenated 18S rDNA, ITS1, and 28S rDNA sequences showed that species of Dactylogyrus parasitizing Nearctic cypriniform fishes (16 species of Leuciscidae and two species of Catostomidae) form two independent clades with different origins [82]. The purpose of this study was to provide a connection between the molecular and morphological data on the specimens of Dactylogyrus spp. included in the phylogenetic analyses. In this paper, 28 of the 32 species of Dactylogyrus are morphologically vouchered together with illustrations of the MCOs taken from the respective hologenophores. Seven of the unidentified species of Dactylogyrus reported in Šimková et al. [82] are formally described here as new to science.

Materials and methods

Fish sampling

Fish hosts (two species of Catostomidae and 16 species of Leuciscidae) were captured by electrofishing or seine nets from several localities in four US states (Arkansas, Mississippi, New York, and Wisconsin) from 2018 to 2019 (Table 1). Fieldwork was carried out with the approval of the official local authorities (provided to US partners listed in the acknowledgements). Fishes were identified in the field by local collaborators familiar with the local fish fauna, and the identification was subsequently confirmed using sequences of the cytochrome b (cyt b) mitochondrial gene (see below). Scientific names and the systematic classification of fishes presented here follow Eschmeyer’s Catalog of Fishes [26]; host names used in the original descriptions of Dactylogyrus spp. are retained in parentheses as synonyms. Fishes were transported alive to the laboratory and kept in aerated containers until necropsied within three days of capture. They were killed by transection of the spinal cord and immediately examined for parasites.

Table 1

List of Dactylogyrus species used in phylogenetic analyses, their cypriniform host species, locality of collection, GenBank accession numbers for DNA sequences, and MNHN accession numbers for hologenophores.

Parasite sampling

Host gills were removed, placed in Petri dishes with tap water, and observed under a stereomicroscope (Olympus SZX7, Tokyo, Japan) for the presence of parasites. Monogeneans were collected using fine dissection needles and prepared according to Řehulková [70]. Some worms were mounted on slides under different levels of coverslip pressure and fixed with a mixture of glycerine and ammonium picrate (GAP) [44] for morphological analysis. Other specimens were bisected using fine needles: one half of the body (either the posterior part containing haptoral sclerites or the anterior part with the MCO) was fixed in 96% ethanol for later DNA extraction; the other half was mounted on a slide, fixed with GAP for species identification, and kept as a hologenophore (sensu Pleijel et al. [61]). The mounted specimens (or their parts) were studied using an Olympus BX61 (Tokyo, Japan) microscope equipped with phase contrast optics. Illustrations were made with the aid of a drawing attachment, scanned, and redrawn with a graphics tablet (Wacom Intuos5 Touch) compatible with Adobe Illustrator software (Adobe Systems Inc., San Jose, CA, USA). Measurements were captured using an Olympus digital camera and Stream Motion 1.9.2 image analysis software (Olympus). Measurements (in micrometers) are given as the mean followed by the range and the number (n) of specimens measured in parentheses. Body length includes the length of the haptor. The numbering of hook pairs follows the system recommended by Mizelle [49]. After morphometric analysis, the specimens (or their parts) fixed with GAP were re-mounted in Canada balsam following the procedure described by Ergens [25].

Type and voucher specimens of Dactylogyrus spp. were deposited in the Muséum National d’Histoire Naturelle (MNHN), Paris, France, as indicated in the respective species accounts and Table 1. For comparative purposes, the following type specimens of four species of Dactylogyrus deposited at the USNM collection were studied: D. acicularis Rogers, 1967 (USNM 061368; two paratypes), D. apos Mueller, 1938 (USNM 071443; three cotypes), D. eos Hanek, Molnár & Fernando, 1975 (USNM 73154; two paratypes), and D. niger Rogers & Mizelle, 1966 (USNM 060789; two paratypes).

DNA extraction, amplification, and sequencing

For the molecular characterization of the studied species of Dactylogyrus, two rDNA fragments (a partial 28S rDNA and a fragment comprising a partial 18S rDNA and ITS1) were analyzed. The sequences of these target genes were generated as part of the previously published phylogenetic study [82], in which the DNA isolation, amplification, and sequencing processes were described in detail (see Table 1 for accession numbers).

Fish identification was confirmed using sequences of the cyt b mitochondrial gene and a sequence similarity approach employing the Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Amplification of an approximately 1050 bp-long fragment of cyt b was performed using the primers GluF (forward, 5′–AACCACCGTTGTATTCAACTACAA–3′) and ThrR (reverse, 5′–ACCTCCGATCTTCGGATTACAAGACCG–3′) [43]. The DNA of host species was isolated from fin clips preserved in 96% ethanol using a DNeasy® Blood & Tissue Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. PCR reactions consisted of 1 U of Taq polymerase (Fermentas), 1× PCR buffer, 1.5 mM MgCl2, 0.4 mM of each dNTP, 0.4 μM of each primer, and an aliquot of 30 ng (1 μl) of genomic DNA in a total volume of 25 μL. The PCR was carried out in a Mastercycler ep gradient S instrument (Eppendorf) with the following steps: 2 min at 94 °C followed by 39 cycles of 45 s at 92 °C, 90 s at 48 °C, and 105 s at 72 °C, and 7 min of final elongation at 72 °C. PCR products were purified by ExoSAP–IT™ (Amplia, Bratislava, Slovakia) and were sequenced directly in both directions using the same primers as in the amplification reaction. Sequencing was carried out using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems by Thermo Fisher Scientific, Prague, Czech Republic) and an Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems). The obtained sequences were assembled and edited using Sequencer software (Gene Codes Corp., Ann Arbor, MI, USA).

Phylogenetic analyses

Bayesian Inference (BI) and Maximum Likelihood (ML) analyses were performed on the concatenated dataset of 18S rDNA, ITS1 and 28S rDNA. The final nucleotide sequence alignment contained sequences of 28 North American Dactylogyrus species (7 new and 21 previously described) and seven species of Dactylogyrus from Palaearctic cyprinids and leuciscids representing members of phylogenetic Dactylogyrus lineage IV (see Šimková et al. [82]). Three Dactylogyrus species (D. intermedius Wegener, 1910, D. vastator Nybelin, 1937 and D. marocanus El Gharbi, Birgi & Lambert, 1994) representing members of phylogenetic Dactylogyrus lineage III (see Šimková et al. [82]) were used as an outgroup (Table 1). Sequences were aligned separately for each gene in MAFFT v.7 [37, 38] using the G-INS-i algorithm. The best-fit sequence substitution models were determined for each partition on the basis of the Bayesian Information Criterion (BIC) using ModelFinder [36] implemented in IQ-TREE [59]. The K2P+I+G model for 18S rDNA, the TIM2e+G model for ITS1, and the GTR+F+I+G model for 28S rDNA dataset were selected. BI analysis was conducted using MrBayes v.3.2 [76]. Two independent Metropolis-coupled Markov chain Monte Carlo (MCMCMC) analyses were run. Four chains were used (one heated, three cold), running for 10 million generations. Tree topologies were sampled every 100th generation, whereby the first 25% of trees from each run were discarded as burn-in. The remaining trees were used to construct majority-rule consensus trees and determine the Bayesian Posterior Probability (BPP) for each clade. The chain convergence and Effective Sampling Sizes (ESS) of all parameters were checked in Tracer v.1.7 [69]. ML analysis was performed in IQ-TREE v.2 [59] using a partition-based approach. To estimate the topological support, 1000 bootstrap replicates were calculated using UltraFast Bootstrap approximation (UFBoot) [34]. The obtained trees for BI and ML were visualized in FigTree v.1.4.3 [68].

Results

Eighteen of the 28 species (64%) of North American cypriniforms examined for monogeneans were positive for Dactylogyrus spp. Two fish species, namely Campostoma spadiceum (Arkansas) and Notropis petersoni (Mississippi), were recorded as hosts of Dactylogyrus spp. as well as of monogeneans for the first time. Seven new and 21 previously described species of Dactylogyrus were described and reported; these species are listed in Table 1, including their host(s) and locality. Four species of Dactylogyrus (i.e., Dactylogyrus sp. 3, 7, 8, and 9 reported in Šimková et al. [82], probably new to science, were not formally described here due to the insufficient number of specimens available. Twenty-eight Dactylogyrus species parasitizing mostly species of Nearctic Leuciscidae and forming two phylogenetic clades with different origins [82] are here divided into two main morphological groups on the basis of the MCO. Twenty-two species of strictly Nearctic Dactylogyrus form a monophyletic group and share the “nearctic” morphological type of MCO. This type is characterized by an accessory piece bifurcated into two unequal rami. To avoid confusion, we termed the individual rami “left” and “right” with respect to the medial body axis from the ventral view. The right ramus is usually shorter than the left one and possesses lightly sclerotized supplementary pieces supporting/guiding the copulatory tube. A link between the phylogenetic reconstruction and the morphological interspecific similarities of Dactylogyrus spp. presented in this study is discussed after the descriptions and redescriptions of the seven new and three previously described species, respectively.

Dactylogyrus aduncus n. sp. (Fig. 1)

urn:lsid:zoobank.org:act:A88A82D5-3FC6-46D5-9A2E-CFDDF88827D3

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

Sclerotized structures of Dactylogyrus aduncus n. sp. ex Campostoma spadiceum. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

Synonym: Dactylogyrus sp. 4 sensu Šimková et al. [82].

Type host: Campostoma spadiceum (Girard, 1856), Leuciscidae (Pogonichthyinae).

Type locality: Arkansas, Bear Creek (Garland Co.).

Other locality: Arkansas, Big Fork Creek (Polk Co.).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 45% (5 fish infected/11 fish examined); 1–5 monogeneans per infected host.

Type-specimens and specimens deposited: Holotype (MNHN HEL1932); two paratypes (MNHN HEL1933-1934); one hologenophore (MNHN HEL1954).

Etymology: The specific name (an adjective) is from Latin (aduncus = hooked) and refers to the tip of the copulatory tube.

Description (based on 4 specimens in GAP and 6 hologenophores): Anchors thick, with moderately long inner root (approx. 2.5 times the length of outer root), well-developed rounded outer root, medially slightly constricted bent shaft, and point with recurved tip extending to level of tip of inner root. Dorsal bar yoke-shaped. Ventral bar broadly V-shaped with anteromedial knob. One pair of needles located near hooks of pair V. Hooks with delicate point, terminally flattened thumb, shank comprised of 2 subunits (proximal expansion 0.4–0.5 shank length); filamentous hooklet (FH) loop extending nearly to union of shaft subunits. MCO composed of basally articulated copulatory tube and accessory piece. Copulatory tube with funnel-shaped base surrounded by flange; shaft slightly bent, with subterminal opening and finger-like tip recurved at right angle. Accessory piece bifurcated into two unequal rami; right ramus shorter, with a delicate (poorly detectable even under phase contrast microscopy) sleeve-like membrane arising from its termination and appearing to be associated with the distal part of left ramus. Vagina not observed.

Measurements: Body 476 (469–484; n = 3) long; greatest width 68 (61–74; n = 3). Haptor 60 (59–60; n = 3) long, 98 (95–100; n = 3) wide. Anchor: total length 38 (34–40; n = 5); inner root length 14 (11–16; n = 5); outer root length 6 (5–7; n = 5); point length 10 (9–10; n = 5). Dorsal bar 26 (22–30; n = 5) long. Ventral bar 24 (20–29; n = 5) long. Hooks (I–VII) 19 (16–22; n = 5) long: pair I 18 (18–19), pair II 17 (16–18), pair III 21 (20–22), pair IV 22 (21–22), pair V 20 (19–22), pair VI 18 (17–19) and pair VII 19 (19–20). MCO: total straight length 30 (26–34; n = 5); tube trace length 26 (23–28; n = 5).

Remarks: Dactylogyrus aduncus n. sp. is easily differentiated from all other known congeners parasitizing North American cypriniforms by having a copulatory tube with a subterminal opening and finger-like termination recurved at a right angle. In addition, the anchors of the new species are relatively thick and possess a point with a recurved tip. This new species represents the first record of monogeneans on C. spadiceum. Up to now, four species of Dactylogyrus have been reported on two species of Campostoma, namely D. acus Mueller, 1938 (from Campostoma anomalum (Rafinesque); [57]), D. georgiensis Price, 1967 (from C. anomalum; [65]), D. katherineae Price, 1967 (from C. anomalum and C. oligolepis Hubbs & Green; [13, 14, 65]), and D. semotilus Wood & Mizelle, 1957 (from C. anomalum; [72]). Of the four species, D. aduncus n. sp. is most similar to D. georgiensis, from which it clearly differs, in addition to the above, by having a copulatory tube with comparatively smaller base.

Dactylogyrus cloutmani n. sp. (Fig. 2)

urn:lsid:zoobank.org:act:F82C1D7D-B50B-453C-B30C-D398F7FCF0B8

Thumbnail: Figure 2 Refer to the following caption and surrounding text. Figure 2

Sclerotized structures of Dactylogyrus cloutmani n. sp. ex Luxilus chrysocephalus isolepis. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

Synonym: Dactylogyrus sp. 1 sensu Šimková et al. [82].

Type host: Luxilus chrysocephalus isolepis (Hubbs & Brown, 1927), Leuciscidae (Pogonichthyinae).

Type locality: Arkansas, Caddo River (Montgomery Co.).

Other locality: Arkansas, Big Fork Creek (Polk Co.)

Site on host: Gill lamellae.

Prevalence and intensity of infection: 100% (3 fishes examined and infected); 3–8 monogeneans per infected host.

Type-specimens and specimens deposited: Holotype (MNHN HEL1939); six paratypes (MNHN HEL1940-1942); two hologenophores (MNHN HEL1969-1970).

Etymology: This species is named after Dr. Donald G. Cloutman (Kansas) in recognition of his contributions to the systematics and taxonomy of monogeneans parasitizing fishes in the United States.

Description (based on 10 specimens in GAP and 3 hologenophores): Anchors with moderately long inner root (approx. 2.5 times the length of outer root) having flattened termination, well-developed outer root, medially slightly constricted bent shaft, and straight recurved point slightly extending past level of tip of inner root. Dorsal bar nearly yoke-shaped. Ventral bar broadly V-shaped with anteromedial knob. One pair of needles located near hooks of pair V. Hooks with delicate point, small truncate thumb, shank comprised of 2 subunits (proximal expansion about 0.5 shank length); FH loop about 3/4 length of distal portion of shank. MCO composed of basally articulated copulatory tube and accessory piece. Copulatory tube with short funnel-shaped base; shaft arced, terminally tapering. Accessory piece bifurcated in its distal third into two unequal rami; left ramus longer, with rounded termination; right ramus shorter, thin, recurved posteriorly, merging with a weakly sclerotized ligament arising from the base of the accessory piece. Vagina not observed.

Measurements: Body 557 (493–731; n = 4) long; greatest width 86 (63–104; n = 4). Haptor 78 (70–84; n = 4) long, 102 (91–107; n = 4) wide. Anchor: total length 40 (35–41; n = 8); inner root length 11 (8–13; n = 8); outer root length 5 (3–7; n = 8); point length 10 (9–11; n = 8). Dorsal bar 23 (20–27; n = 8) long. Ventral bar 25 (24–27; n = 8) long. Hooks (I–VII) 24 (19–31; n = 8) long: pair I 23 (19–25) long, pair II 23 (20–25) long, pair III 28 (22–31), pair IV 24 (20–26), pair V 23 (20–26), pair VI 23 (19–25), and pair VII 25 (23–27). MCO: total straight length 29 (27–32; n = 8); tube trace length 31 (28–34; n = 8).

Remarks: Dactylogyrus cloutmani n. sp. is similar to Dactylogyrus cursitans Rogers, 1967 described from the same host species, Luxilus chrysocephalus isolepis (syn. Notropis chrysocephalus isolepis), in Alabama [72]. On the basis of Rogers’s original drawings of the sclerotized structures, D. cloutmani n. sp. differs from the latter species by the rounded termination of the left ramus (termination acute in D. cursitans) and by the presence of the ligament arising from the base of the accessory piece and merging with the right ramus into the form of a tongue-like grooved portion (probably serving as a guide for the distal third of the copulatory tube). In North America, Luxilus chrysocephalus chrysocephalus is among the cypriniform hosts with the highest monogenean species richness [41]. In the present study, specimens of D. cloutmani n. sp. co-occurred together with those of Dactylogyrus arcus Rogers, 1967, Dactylogyrus bulbus Mueller, 1938, and Dactylogyrus perlus Mueller, 1938. The description of D. cloutmani n. sp. increases the known number of Dactylogyrus spp. reported on this host species to 11.

Dactylogyrus cornifrons n. sp. (Fig. 3)

urn:lsid:zoobank.org:act:5889A182-0F26-4A76-988D-6E5482474EE2

Thumbnail: Figure 3 Refer to the following caption and surrounding text. Figure 3

Sclerotized structures of Dactylogyrus cornifrons n. sp. ex Cyprinella venusta. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

Synonym: Dactylogyrus sp. 2 variant B sensu Šimková et al. [82].

Type host: Cyprinella venusta Girard, 1856, Leuciscidae (Pogonichthyinae).

Type locality: Mississippi, Pascagoula River (Moon Lake).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 50% (6 of 12 fishes infected); 1–7 monogeneans per infected host.

Type-specimens and specimens deposited: Holotype (MNHN HEL1943); three paratypes (MNHN HEL1943-1945); two hologenophores (MNHN HEL1972-1973).

Etymology: The specific name (an adjective) is from Latin (cornifrons = having horns on the forehead) and refers to the shape of the accessory piece resembling the “sign of the horns” hand gesture.

Description (based on 6 specimens in GAP and 7 hologenophores): Anchors with moderately long inner root (approximately 2.5 times the length of outer root) having flattened termination, well-developed outer root, medially slightly constricted bent shaft, and straight recurved point slightly extending past level of tip of inner root. Dorsal bar nearly yoke-shaped. Ventral bar inverted V-shaped with anteromedial knob. One pair of needles located near hooks of pair V. Hooks with delicate point, small truncate thumb, shank comprised of 2 subunits (proximal expansion 0.3–0.4 shank length); FH loop about 3/4 length of distal portion of shank. MCO composed of basally articulated copulatory tube and accessory piece. Copulatory tube with base extended anteriorly into grooved heel-like projection; shaft nearly C-shaped, with flared distal end. Accessory piece medially bifurcated into two unequal rami; left ramus elongated, gently arched, slightly irregular in diameter, with diagonally truncate termination; right ramus terminally recurved into slightly sclerotized part forming a loop and bearing anteriorly projecting thin filament with acute termination. Vagina not observed.

Measurements: Body 410 (304–489; n = 3) long; greatest width 71 (52–92; n = 3). Haptor 55 (44–46; n = 3) long, 77 (68–86; n = 3) wide. Anchor: total length 31 (28–32; n = 5); inner root length 10 (9–12; n = 5); outer root length 4 (4–5; n = 5); point length 9 (8–9; n = 5). Dorsal bar 20 (17–22; n = 5) long. Ventral bar 18 (16–19; n = 5) long. Hooks (I–VII) 20 (16–23; n = 5) long: pair I 19 (17–20), pair II 19 (19–20), pair III 22 (20–23), pair IV 19 (18–20), pair V 20 (18–21), pair VI 18 (16–18), and pair VII 21 (20–22). MCO: total straight length 33 (29–38; n = 5); tube trace length 35 (30–41; n = 5).

Remarks: Dactylogyrus cornifrons n. sp. belongs to the group of congeners that have a base of the copulatory tube with an anteriorly protruding heel-like process (=heel). These include a number of Dactylogyrus species parasitizing North American Cyprinoidei, most frequently species of the Pogonichthyinae. The morphology of the haptoral sclerites and MCO in D. cornifrons n. sp. is most similar to that originally described for Dactylogyrus venusti Rogers, 1967 from the same host species in Alabama and Louisiana (see Figs. 182–188 in Rogers [72]). In the present study, both species co-occurred in the same host individuals and share the following characters: anchors with an elongate shaft and recurved straight point, a V-shaped ventral bar with an anteromedial knob-like projection, a thick nearly yoke-shaped ventral bar, a copulatory tube with a well-developed basal heel, and an accessory piece with the right ramus bearing an anteriorly projecting lightly sclerotized filament (see Fig. 12 for comparison). The left ramus and the filament curve inward to give them a pincer-like appearance. In young specimens of D. cornifrons n. sp., however, the filament is not well-developed in comparison to the other parts of the accessory piece, and therefore may not be detectable. Dactylogyrus cornifrons n. sp. clearly differs from D. venusti by having a copulatory tube with a shorter basal heel (i.e., reaching the level of the proximal 1/3 of the shaft vs the level of the middle of the shaft in D. venusti) and an accessory piece with the right ramus terminally recurved into a slightly sclerotized loop (without a loop in D. venusti). In addition, in fixed specimens of D. cornifrons n. sp., the copulatory tube curves towards the right ramus (more specifically to its filament), while in D. venusti it is curved towards the left ramus, as in most North American Dactylogyrus spp. of the same (“nearctic”) type of MCO.

Dactylogyrus perlus Mueller, 1938 (Fig. 4)

Synonym: Dactylogyrus banghami Mizelle & Donahue, 1944 [16].

Thumbnail: Figure 4 Refer to the following caption and surrounding text. Figure 4

Sclerotized structures of Dactylogyrus perlus Mueller, 1938 ex Luxilus chrysocephalus isolepis. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; VG – vagina; MCO – male copulatory organ.

Type host: Luxilus cornutus (Mitchill, 1817) (syn. Notropis cornutus), Leuciscidae (Pogonichthyinae).

Type locality: New York, Chautauqua Lake.

Previous records: Luxilus cornutus: New York [57], Ontario (as D. banghami; [52]). Luxilus chrysocephalus: Alabama (as D. banghami of Rogers [72], [18]), Tennessee [16].

Current record: Luxilus chrysocephalus isolepis (Hubbs & Brown, 1927): Arkansas, Big Fork Creek (Polk Co.) and Caddo River (Montgomery Co.).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 83% (5 fish infected/6 fish examined); 3–10 monogeneans per infected host.

Specimens deposited: Three morphological vouchers together with D. bulbus (MNHN HEL1953); two hologenophores (MNHN HEL1990-1991).

Redescription (based on 8 specimens in GAP and 5 hologenophores): Anchor with markedly small base in comparison to size of roots; inner root long (approx. 3 times the length of outer root), nearly uniform in diameter, with flattened termination; outer root well-developed; shaft short, medially slightly constricted; point situated almost perpendicularly to shaft, with recurved tip, extending short of level of tip of inner root. Dorsal bar broadly V-shaped, with poorly visible medial membrane. Ventral bar vestigial, straight, with slight posteromedial expansion. One pair of needles located near hooks of pair V. Hooks with delicate point, small truncate thumb, shank comprised of 2 subunits (proximal expansion about 0.4 shank length); FH loop extending nearly to union of shaft subunits. MCO composed of basally articulated copulatory tube and accessory piece. Copulatory tube with robust base and short arched shaft; base extended anteriorly into relatively short and wide heel; shaft with distal 1/3 diagonally truncate. Accessory piece bifurcated medially into two unequal rami; left ramus with hooked termination; right ramus recurved posteriorly; a weakly sclerotized ligament arising from its base towards right ramus. Vagina a plate-like structure, appearing to be 3-lobed, with tunnel-like opening.

Measurements: Body 449 (289–631; n = 3) long; greatest width 82 (66–98; n = 3). Haptor 62 (40–82; n = 3) long, 83 (69–90; n = 3) wide. Anchor: total length 24 (22–25; n = 6); inner root length 13 (12–14; n = 6); outer root length 3 (3–5; n = 6); point length 8 (7–8; n = 6). Dorsal bar 22 (20–24; n = 6) long. Ventral bar 16 (15–18; n = 6) long. Hooks (I–VII) 15 (13–18; n = 6) long: pair I 15 (13–16), pair II 15 (14–17), pair III 16 (14–18), pair IV 15 (14–17), pair V 15 (14–16), pair VI 16 (14–17) and pair VII 15 (14–16). MCO: total straight length 43 (30–49; n = 6); tube trace length 30 (26–36; n = 6). Vagina 27 (20–39; n = 6) long, 25 (17–41; n = 6).

Remarks: Dactylogyrus perlus was found in association with three other species of Dactylogyrus (i.e., D. arcus, D. bulbus, and D. cloutmani n. sp.) on the gills of the striped shiner collected in Arkansas (=new locality record). Unlike the three mentioned species, D. perlus belongs to the group of congeners that possess anchors with a point having a recurved tip and forming an acute or right angle with a relatively short shaft. The morphology of the haptoral and reproductive structures in the current specimens generally corresponds to that originally described by Mueller [57] and later redescribed by Mizelle and Donahue [52]. Our microscopic observation under phase-contrast optics additionally revealed the presence of an anteromedial membrane associated with the dorsal bar that is broadly V-shaped rather than straight, as depicted in the previous descriptions [52, 57].

After examination of the type specimens of D. perlus and D. banghami Mizelle & Donahue, 1944, Cloutman [16] considered the latter species as a junior synonym of D. perlus. Without providing any drawings and measurements, he based the synonymy on their mutual host and on the morphological similarity of the sclerotized structures in both species. Cloutman [16] stated that syntypes of D. perlus have an anteriorly directed process on the base of the copulatory tube (as in cotypes of D. banghami), a feature whose presence/absence Mizelle and Donahue [52] is reportedly considered important for distinguishing the two mentioned species. Dactylogyrus banghami has been reported from a variety of leuciscid host species and localities in eastern North America (see Hoffman [35]). However, according to Hanek et al. [32] and Cloutman [16], D. banghami (=D. perlus) represents a complex of morphologically similar species that needs to be revised, and in which D. perlus (sensu stricto) appears to be restricted on species of Luxilus Rafinesque [16, 18, 20]. The similarity of the species in the complex is given by the shape of both the anchors (see above in the remarks) and the MCO, which is composed of (i) a copulatory tube with a large base, having an anteriorly directed process (heel) and a slightly arched shaft with a diagonally truncated distal end, and (ii) an accessory piece medially bifurcated into two unequal rami (the left ramus with a hooked termination; the right ramus recurved posteriorly). Within the D. perlus (=banghami) complex, D. perlus (s.s.) most closely resembles D. beckeri Cloutman, 1987 and D. confusus Mueller, 1938 described from Cyprinella galactura (Cope) and Clinostomus elongatus (Kirtland) [15, 57], respectively, by having a relatively short basal heel in the copulatory tube. It differs from both species by having an accessory piece with rami of similar length (the left ramus is slightly longer than the right one in D. beckeri and D. confusus). In addition, D. perlus differs from D. beckeri by having a smaller MCO (i.e., 43 (30–49) vs 58 (46–65) in D. beckeri), while the anchors are of similar size in both species, and from D. confusus by having a basal heel of the copulatory tube shorter than the remaining part of the base (measured from the midpoint of the base opening) (the basal heel is slightly longer in D. confusus).

Dactylogyrus mcallisteri n. sp. (Fig. 5)

urn:lsid:zoobank.org:act:583F022F-16CB-49C0-A3F7-313B9203DBB1

Thumbnail: Figure 5 Refer to the following caption and surrounding text. Figure 5

Sclerotized structures of Dactylogyrus mcallisteri n. sp. (A) and D. atromaculatus Mizelle, 1938 (B) ex Semotilus atromaculatus from Arkansas and Wisconsin, respectively. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

Synonym: Dactylogyrus cf. atromaculatus variant A sensu Šimková et al. [82].

Type host: Semotilus atromaculatus (Mitchill, 1818), Leuciscidae (Plagopterinae).

Type locality: Arkansas, Big Fork Creek (Polk Co.).

Other locality: Arkansas, Bear Creek (Garland Co.).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 100% (7 fish infected/7 fish examined); 3–15 monogeneans per infected host.

Type-specimens and specimens deposited: Holotype (MNHN HEL1949); three hologenophores (MNHN HEL1980-1982).

Etymology: This species is named after Dr. Chris T. McAllister, Eastern Oklahoma State College, Idabel, Oklahoma, in recognition of his contributions to the taxonomy and systematics of North American fish parasites.

Description (based on 5 specimens in GAP and 3 hologenophores): Anchors with moderately long inner root (approx. 3 times the length of outer root) having flattened and slightly recurved termination, well-developed outer root, evenly curved shaft and point; point elongated, extending past level of tip of inner root. Dorsal bar rod shaped, with ends bevelled inwards. Ventral bar vestigial, with anteromedial bulbous expansion. One pair of needles located near hooks of pair V. Hooks with delicate point, small truncate thumb, shank comprised of 2 subunits (proximal expansion approx. 0.4 shank length); FH loop about 3/4 length of distal portion of shank. MCO composed of basally articulated copulatory tube and accessory piece. Copulatory tube with base having anterior and posterior flange; shaft relatively short (slightly longer than base), straight to slightly bent, with distal smaller half diagonally truncate. Accessory piece medially bifurcated into two unequal rami; left ramus elongated, gently arched, almost corresponding in shape and size to the distal half of the tube; right ramus bearing a plate passing diagonally across the base of the accessory piece.

Measurements: Body 667 (593–755; n = 3) long; greatest width 94 (75–115; n = 3). Haptor 66 (63–71; n = 3) long, 121 (103–139; n = 3) wide. Anchor: total length 32 (30–33; n = 5); inner root length 14 (13–15; n = 5); outer root length 4 (3–5; n = 5); point length 14 (13–14; n = 5). Dorsal bar 31 (29–33; n = 5) long. Ventral bar 14 (13–15; n = 5) long. Hooks (I–VII) 19 (17–22; n = 3) long: pair I 18 (17–19), pair II 19 (17–20), pair III 21 (20–22), pair IV 21 (20–22), pair V 20 (19–21), pair VI 19 (18–20), and pair VII 18 (18–19). MCO: total straight length 36 (33–38; n = 5); tube trace length 36 (34–38; n = 5).

Remarks: Dactylogyrus mcallisteri n. sp. is morphologically and genetically close to Dactylogyrus atromaculatus Mizelle, 1938, which was described and recorded on the same host species in Illinois [51], Ontario [24], and Wisconsin (present study). Both species possess almost identical haptoral structures (see Fig. 5), but they are easily distinguished by the comparative morphology of the MCO: (i) the basal flange of the copulatory tube extends anteriorly into a cloud shaped structure in D. mcallisteri n. sp. (absent in D. atromaculatus); (ii) the copulatory tube of D. mcallisteri n. sp. is characterized by a shaft almost the same length as its base (the shaft is thinner and longer in D. atromaculatus); and (iii) the distal diagonally truncated (or attenuated) part of the shaft goes almost one time into the shaft length in the new species (vs ca. 4 times into the shaft length in D. atromaculatus). Within North American cypriniform fishes, Semotilus atromaculatus is known as the host with the second-highest species richness of monogeneans [41]. The finding of D. mcallisteri n. sp. raises the species numbers of monogeneans and Dactylogyrus known from this host species to thirteen and nine, respectively.

Dactylogyrus chieni n. sp. (Fig. 6)

urn:lsid:zoobank.org:act:BF65A554-E6D2-40B2-9764-49C8C4721070

Thumbnail: Figure 6 Refer to the following caption and surrounding text. Figure 6

Sclerotized structures of Dactylogyrus chieni n. sp. ex Hypentelium nigricans. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; VG – vagina; MCO – male copulatory organ.

Synonym: Dactylogyrus sp. 5 of Šimková et al. [82].

Type host: Hypentelium nigricans (Lesueur, 1817), Catostomidae (Catostominae).

Type locality: Arkansas, Huddleston Creek (Montgomery Co.).

Other locality: Arkansas, Walnut Creek (Garland Co.).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 100% (3 fish infected/3 fish examined); 2–5 monogeneans per infected host.

Type-specimens and specimens deposited: Holotype (MNHN HEL1935); five paratypes (MNHN HEL1936-1938); two hologenophores (MNHN HEL1965-1966).

Etymology: This species is named after Dr. Shih Ming Chien in recognition of his contributions to the systematics and taxonomy of monogeneans parasitizing fishes in the United States.

Comparative material studied: D. apos Mueller, 1938 (USNM 071443; three cotypes) from H. nigricans; D. niger Rogers & Mizelle, 1966 (USNM 060789; two paratypes) from Moxostoma duquesnei.

Description (based on 9 specimens in GAP and 3 hologenophores): Anchors with elongate inner root (approx. 3 times the length of outer root) having slightly flattened termination, well-developed outer root, medially slightly constricted bent shaft, and straight sharply recurved point extending past level of tip of inner root. Dorsal bar rod-shaped or gently bent posteriorly in midregion, with subterminal bilateral notches on posterior border. Ventral bar vestigial, rod-shaped, with slight posteromedial expansion and irregular margins. One pair of needles located near hooks of pair V. Hooks with delicate point, upright acute thumb, shank comprised of 2 subunits (proximal expansion 0.4–0.5 shank length); FH loop extending nearly to union of shaft subunits. MCO robust, composed of basally articulated copulatory tube and accessory piece. Copulatory tube with markedly elongate base and short arched shaft; base extended anteriorly into poorly defined heel-like projection. Accessory piece broadly V-shaped, with virtually non-existent base, appearing articulated to the base of copulatory tube at its midlength; left (posterior) ramus distally with two claws in tandem position (subterminal claw with serrated margins, appearing lightly sclerotized and bearing poorly defined membrane); right (anterior) ramus grooved, distally with lightly sclerotized rounded extension. Vagina scoop-shaped, with three prominent spikes; one spike curved; two (long, short) relatively straight.

Measurements: Body 343 (253–417; n = 3) long; greatest width 50 (43–60; n = 3). Haptor 52 (47–55; n = 3) long, 62 (59–69; n = 3) wide. Anchor: total length 34 (32–38; n = 9); inner root length 11 (9–13; n = 9); outer root length 3 (3–4; n = 9); point length 13 (11–15; n = 9). Dorsal bar 23 (21–26; n = 9) long. Ventral bar 12 (10–13; n = 9) long. Hooks (I–VII) 22 (18–29; n = 6) long: pair I 21 (19–23), pair II 23 (21–27), pair III 26 (24–29), pair IV 25 (23–28), pair V 20 (19–22), pair VI 21 (18–23) and pair VII 20 (19–22). MCO: total straight length 31 (29–34; n = 9); tube trace length 24 (22–27; n = 9). Vagina: greatest length 16 (10–23; n = 9); greatest width 7 (6–10; n = 9).

Remarks: Dactylogyrus chieni n. sp. belongs to the group of congeners having an MCO with a huge elongate base, short arched shaft, and a broadly V-shaped accessory piece. These include D. acicularis Rogers, 1967, D. apos Mueller, 1938, D. duquesni Mueller, 1938, D. hamatus Rogers & Mizelle, 1966, D. haneki n. sp., D. niger Rogers & Mizelle, 1966 and D. plumbeus Rogers & Mizelle, 1966, all parasites of moxostomatins and thoburniins (Catostominae). In addition, all of these species share morphologically similar haptoral structures: anchors with an elongate shaft (i.e., longer than the part including the base and roots) and recurved straight point, a relatively straight dorsal bar, and a delicate (vestigial) ventral bar with a slight medial expansion and irregular margins. Dactylogyrus chieni n. sp. seems to be different from all the species in the group by possessing a heel-like projection protruding anteriorly from the distal part of the base of the copulatory tube. However, this feature was not very visible in some specimens examined, and therefore its presence/absence in the species of the group could not be verified with certainty without a deeper examination of their type specimens. Leaving aside this feature, D. chieni n. sp. appears most similar to D. niger (from Moxostoma duquesnei (Lesueur), Alabama; [73]) by having a relatively stout accessory piece with a virtually non-existent base and rami of similar length that are positioned laterally and nearly parallel to the shaft of the copulatory tube. Dactylogyrus chieni n. sp. clearly differs from D. niger by having the left (posterior) ramus distally modified into two claws in a tandem position (the posterior ramus appearing simple and having a slightly hooked termination in D. niger). According to this character, D. chieni n. sp. seems to be similar to D. apos described from the same host species in New York by Mueller [57]. However, Mueller’s [57] three original drawings of the MCO clearly show the accessory piece as having a short base (vs a non-visible base in D. chieni n. sp.) bifurcated into two rami which lie perpendicular to the shaft of the copulatory tube. In addition, the right ramus of the accessory piece in D. apos is curved terminally around the distal part of the copulatory tube, while the respective ramus in D. chieni n. sp. is grooved and distally extended with a lightly sclerotized rounded flap.

Dactylogyrus haneki n. sp. (Fig. 7)

urn:lsid:zoobank.org:act:087E6D6F-CB20-44D2-A1D8-A9FA0F09A4CF

Thumbnail: Figure 7 Refer to the following caption and surrounding text. Figure 7

Sclerotized structures of Dactylogyrus haneki n. sp. ex Hypentelium nigricans. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; VG – vagina; MCO – male copulatory organ.

Synonym: Dactylogyrus sp. 6 sensu Šimková et al. [82].

Type host: Hypentelium nigricans (Lesueur, 1817), Catostomidae (Catostominae).

Type locality: Arkansas, Huddleston Creek (Montgomery Co.).

Other locality: Arkansas, Walnut Creek (Garland Co.).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 67% (2 fish infected/3 fish examined); 2–4 monogeneans per infected host.

Type-specimens and specimens deposited: Holotype (MNHN HEL1947); one paratype (MNHN HEL1948); two hologenophores (MNHN HEL1977-1978).

Etymology: This species is named after Dr. George Hanek in recognition of his contributions to the systematics and taxonomy of monogeneans parasitizing fishes in Canada.

Comparative material studied: D. acicularis Rogers, 1967 (USNM 061368; two paratypes) from Moxostoma poecilurum; D. apos Mueller, 1938 (USNM 071443; three cotypes) from H. nigricans.

Description (based on 2 specimens in GAP and 4 hologenophores): Anchors with elongate inner root (approx. 4 times the length of outer root) having slightly flattened termination, rounded outer root, medially slightly constricted bent shaft, and straight sharply recurved point extending past level of tip of inner root. Dorsal bar yoke-shaped, with subterminal bilateral notches on posterior border. Ventral bar vestigial, rod-shaped, with slight posteromedial expansion and irregular margins. One pair of needles located near hooks of pair V. Hooks with delicate point, upright acute thumb, shank comprised of 2 subunits (proximal expansion about 0.5 shank length); FH loop extending nearly to union of shaft subunits. MCO massive, composed of basally articulated copulatory tube and accessory piece. Copulatory tube with markedly elongate base and short arched shaft. Accessory piece broadly V-shaped, with short base bifurcated into two unequal rami; left ramus longer, claw-shaped, submedially with hump on inner surface; right ramus shorter, rounded, distally with lightly sclerotized joint-like extension. Vagina a massive plate-like structure with irregular margins, occasionally with centrally situated part resembling snail operculum.

Measurements: Body 433 (399–468; n = 2) long; greatest width 65 (61–69; n = 2). Haptor 88 (80–96; n = 2) long, 115 (103–127; n = 2) wide. Anchor: total length 46 (43–49; n = 5); inner root length 15 (13–18; n = 5); outer root length 4 (4–5; n = 5); point length 17 (16–18; n = 5). Dorsal bar 31 (29–34; n = 5) long. Ventral bar 15 (14–16; n = 5) long. Hooks (I–VII) 27 (21–34; n = 5) long: pair I 25 (24–28), pair II 27 (25–29), pair III 31 (28–34), pair IV 29 (27–33), pair V 26 (24–29), pair VI 24 (21–26), and pair VII 24 (23–27). MCO: total straight length 41 (38–46; n = 5); tube trace length 23 (21–24; n = 5). Vagina: greatest length 23 (15–29; n = 5); greatest width 21 (13–25; n = 5).

Remarks: Dactylogyrus haneki n. sp. was collected from the gills of the northern hog sucker (H. nigricans) in association with D. chieni n. sp. Morphologically, D. haneki n. sp. belongs to the same group as the latter species, and appears most similar to D. acicularis (from Moxostoma poecilurum Jordan, Alabama and Louisiana; [72]) and D. apos (from H. nigricans, New York; [57]) by having an accessory piece with a well-defined short base and two rami bifurcated almost perpendicularly to the copulatory tube with its shaft passing between them. Dactylogyrus haneki n. sp. is differentiated from both species by having the right ramus of the accessory piece with a rounded joint-like termination (the corresponding ramus in D. acicularis and D. apos having a pointed or recurved termination). Dactylogyrus haneki n. sp. differs further from D. acicularis by having an accessory piece with rami at an angle of 170° to each other (vs 90° to each other in D. acicularis) and from D. apos by having the left ramus of the accessory piece with a claw-shaped termination (the left ramus having a two-pointed termination in the latter species).

Dactylogyrus eos Hanek, Molnár & Fernando, 1975 (Fig. 8)

Synonym: Dactylogyrus sp. 11 sensu Šimková et al. [82].

Thumbnail: Figure 8 Refer to the following caption and surrounding text. Figure 8

Sclerotized structures of Dactylogyrus eos Hanek, Molnár & Fernando, 1975 ex Chrosomus neogaeus. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; VG – vagina; MCO – male copulatory organ.

Type host: Chrosomus eos Cope, 1861; Leuciscidae (Laviniinae).

Type locality: Ontario, Saugeen River (Durham).

Previous records: Chrosomus eos (syn. Phoxinus eos): Ontario [24, 32], New Brunswick [21].

Current record: Chrosomus neogaeus (Cope, 1867): Wisconsin, Mink River (Door Co.).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 23% (3 fish infected/13 fish examined); 1–3 monogeneans per infected host.

Specimens deposited: Morphological voucher (MNHN HEL1950); one hologenophore (MNHN HEL1974).

Comparative material examined: D. eos (USNM 73154, No. 5) from C. eos.

Redescription (based on 3 specimens in GAP and 3 hologenophores): Anchors with moderately long inner root (approximately 2.5 times the length of outer root) having flattened termination, well-developed rounded inner root, elongate shaft forming gentle arc, and straight recurved point extending just past level of tip of inner root. Dorsal bar rod-shaped, with small subterminal notches on posterior border. Ventral bar vestigial, rod-shaped, with slight anteromedial expansion and enlarged ends. One pair of needles located near hooks of pair V. Hooks with delicate point, upright thumb, shank comprised of 2 subunits (proximal expansion less than 0.5 shank length); FH loop about 3/4 length of distal portion of shank. MCO composed of copulatory tube and accessory piece. Copulatory tube a coil of about six rings, with bulbous base. Accessory piece basally articulated to tube base; proximal part a zigzag rod lying within tube rings; distal part resembling an orchid labellum, medially bent at about a right angle, serving as a guide for protruding part of the copulatory tube during copulation. Vagina dextral; composed of a massive plate-like structure, long tortuous vaginal canal, and capsule-shaped distal opening.

Measurements: Body 384 (321–447; n = 3) long; greatest width 42 (42–43; n = 3). Haptor 50 (46–55; n = 3) long, 69 (67–70; n = 3) wide. Anchor: total length 34 (33–35; n = 3); inner root length 8 (8–9; n = 3); outer root length 3 (2–3; n = 3); point length 8 (7–8; n = 3). Dorsal bar 16 (16–17; n = 3) long. Ventral bar 17 (16–17; n = 3) long. Hooks (I–VII) 18 (14–22; n = 3) long: pair I 15 (14–16), pair II 18 (17–19), pair III 20 (20–21), pair IV 20 (18–22), pair V 18 (18–19), pair VI 18 (17–18), and pair VII 19 (18–20). MCO: total straight length 29 (27–31; n = 1); proximal ring diameter 12 (10–13; n = 3). Vagina: plate-like structure 15 (13–17; n = 3) in greatest diameter.

Remarks: Dactylogyrus eos is the only Dactylogyrus species hitherto reported from Nearctic cypriniforms that has a spirally-coiled copulatory tube. This species was described and later reported from Chrosomus eos (syn. Phoxinus eos) in Ontario [24, 32] and New Brunswick [21]. The monogeneans collected from C. neogaeus during the present study generally correspond to the original description of D. eos, but there are some uncertainties mainly concerning the hard reproductive structures (see below).

Although Hanek et al. [32] stated that two paratypes of D. eos were deposited in the USNM, our examination showed that one of them (USNM 73154, No. 6) is represented by the second Dactylogyrus species reported on C. eos as well as C. neogaeus, namely D. chrosomi Hanek, Molnár & Fernando, 1975 [23, 24, 32]. In addition, unfortunately, the only available paratype of D. eos (USNM 73154, No. 5) was contracted and highly transparent. In the original description, Hanek et al. [32] indicated that D. eos possesses an MCO with four coils and that the vagina is muscular, which does not correspond to our specimens. The presence of a long tortuous vaginal canal observed in our specimens from D. neogaeus could not be confirmed with certainty in the paratype of D. eos; however, a suggestion of this structure and the presence of a massive plate-like vaginal part are apparent in the paratype. As for the number of rings of the copulatory tube in our specimens from D. neogaeus, it should be mentioned that only a single specimen was suitable for accurately detecting the course of individual rings. In this specimen, however, a considerable distal portion of the tube appeared to be unwound from the accessory piece, as seen in Figure 8. The spiral nature of the copulatory tube and its basal articulation with the proximal part of the accessory piece lying within the tube coil, along with the copulatory tube partly protruding from the genital pore (or accessory piece) was also observed by Kritsky et al. [40] in specimens of Dawestrema spp. (Dactylogyridae). These authors suggested that the accessory piece in species of Dawestrema may function similarly to the spring mechanism of a self-retracting tape measure. As in species of Dawestrema, the diameter of the tube rings in our specimens from C. neogaeus does not appear to be affected by the extrusion of the terminal part of the tube. In accordance with Kritsky et al. [40], we assume that the protrusion of the copulatory tube during copulation is not the result of a tightening of the tube coil, but rather an unwinding of the tube shaft with the assistance of the proximal part of the accessory piece. However, confirmation of this mechanism will require further investigation, ideally based on the observation of living worms. In view of the above, the course of the copulatory tube is probably somewhat variable and its strict number of coils does not appear to be a consistent character for the identification of this species. Differences observed in the anchors between the paratype of D. eos and our specimens (i.e., a slightly longer inner root compared with the outer root in the paratype) were minimal and fall within expected intraspecific variation among Dactylogyrus species, especially when specimens originate from two different host species and localities. Finally, although Hanek et al. [32] did not mention the presence of the ventral bar and although this structure was not detectable even in the paratype due to its poor condition, in the present specimens from C. neogaeus the ventral bar is visible, albeit poorly, and it is therefore possible that Hanek et al. [32] overlooked its presence in their four specimens.

Thus, on the basis of the above, we tentatively consider the six Dactylogyrus specimens from C. neogaeus to represent D. eos. However, confirmation of this identification will depend on the collection and examination of new parasite material from Chrosomus eos from or near the type locality in Ontario.

Dactylogyrus fimbratus n. sp. (Fig. 9)

urn:lsid:zoobank.org:act:65EF6712-AB73-40FD-B3B3-9847368AF8F5

Thumbnail: Figure 9 Refer to the following caption and surrounding text. Figure 9

Sclerotized structures of Dactylogyrus fimbratus n. sp. ex Rhinichthys cataractae. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

Synonym: Dactylogyrus sp. 10 sensu Šimková et al. [82].

Type host: Rhinichthys cataractae (Valenciennes, 1842), Leuciscidae (Pogonichthyinae).

Type locality: New York, Leatherstocking Creek (Otsego Co.).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 20% (1 fish infected/5 fish examined); 3 monogeneans per infected host.

Type-specimens and specimens deposited: Holotype (MNHN HEL1946); one hologenophore (MNHN HEL1975).

Etymology: The specific name (an adjective) is from Latin (fimbratus = fringed) and refers to the accessory piece of the MCO.

Description (based on two specimens in GAP and one hologenophore): Anchors with short inner root (approx. 1.5 times the length of outer root) having slightly flattened termination, broad outer root, bent shaft, and point extending past level of tip of inner root. Dorsal bar yoke-shaped. Ventral bar vestigial, rod-shaped, with anteromedial expansion. One pair of needles located near hooks of pair V. Hooks with delicate point, upright acute thumb, shank comprised of 2 subunits (proximal expansion about 0.75 shank length); FH loop extending nearly to union of shaft subunits. MCO composed of basally articulated copulatory tube and accessory piece. Copulatory tube with relatively large base extended posteriorly into the shape of a dwarf’s hat; shaft distally slightly recurved, terminally truncated. Accessory piece inverted T-shaped, with swollen recurved distal end; proximal part partly fringed, resembling a wing. Vagina not observed.

Measurements: Body 380 (n = 1) long; greatest width 75 (n = 1). Haptor 58 (n = 1) long, 73 (n = 1) wide. Anchor: total length 35 (34–35; n = 2); inner root length 7 (7–8; n = 2); outer root length 3 (n = 2); point length 9 (8–10; n = 2). Dorsal bar 24 (n = 2) long. Ventral bar 18 (17–18; n = 2) long. Hooks (I–VII) 18 (17–20; n = 2) long: pair I 18, pair II 18, pair III 19 (18–19), pair IV 20, pair V 18, pair VI 18 (17–18), and pair VII 17 (16–17) long. MCO: total straight length 32 (32–33; n = 3); tube trace length 34 (n = 3).

Remarks: On the basis of similarities of the respective haptoral elements and MCOs, Dactylogyrus fimbratus n. sp. resembles Dactylogyrus cheloideus Rogers, 1967 described from Rhinichthys atratulus (Hermann) in Alabama [72] and later reported on the same host in Ontario by Hanek and Furtado [31] as D. atratuli (=synonym for D. cheloideus; [39]). Both species possess roots of similar size (i.e., the inner root is only slightly longer than the outer root), a relatively robust yoke-shaped dorsal bar, and a vestigial ventral bar with anteromedial expansion. In addition, the distal ends of the copulatory tube and accessory piece curve inward to give them a pincer-like appearance in both species. Dactylogyrus fimbratus n. sp. clearly differs from D. cheloideus by having (i) a copulatory tube with a bulbous base extended posteriorly into the shape of a dwarf’s hat (the base reduced in size and truncated in D. cheloideus) and a slightly longer and slender shaft, and (ii) an accessory piece with a swollen distal end (vs a tapered distal end in D. cheloideus) and a partly fringed proximal part (without fringes in D. cheloideus). Although only three specimens of this species were collected from longnose dace, the unique features of the MCO make them sufficiently distinct from all known congeners to be considered as representing a new species of Dactylogyrus.

Dactylogyrus parvicirrus Seamster, 1948 (Fig. 10)

Synonym: Dactylogyrus cf. parvicirrus sensu Šimková et al. [82].

Thumbnail: Figure 10 Refer to the following caption and surrounding text. Figure 10

Sclerotized structures of Dactylogyrus parvicirrus Seamster, 1948 ex Notemigonus crysoleucas. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

Type host: Notemigonus crysoleucas (Mitchill, 1814), Leuciscidae (Leuciscinae).

Type locality: Oklahoma; Culwell’s Pond (Muskogee Co.).

Previous records: Notemigonus crysoleucas: Oklahoma [78], Virginia [33], Texas [60], Alabama [72], Ontario [22, 24], New Brunswick [21].

Current record: Notemigonus crysoleucas: New York, Rom Hill Beaver Pond (Otsego Co.).

Site on host: Gill lamellae.

Prevalence and intensity of infection: 100% (5 fish infected/5 fish examined); 1–8 monogeneans per infected host.

Specimens deposited: Three morphological vouchers (MNHN HEL1951-1952); two hologenophores (MNHN HEL1987-1988).

Redescription (based on 7 specimens in GAP and 3 hologenophores): Anchors with elongate inner root (approx. 3 times the length of outer root) having flattened termination, well-developed outer root, medially slightly constricted bent shaft, and straight recurved point extending to level of tip of inner root. Dorsal bar yoke-shaped, massive. Ventral bar with irregular margins and frayed anteromedial projection. One pair of needles located near hooks of pair V. Hooks with delicate point, small upright thumb, shank comprised of 2 subunits (proximal expansion about 0.5 shank length); FH loop about 3/4 length of distal portion of shank. MCO small in relation to size of haptoral structures, comprises copulatory tube articulated to accessory piece by articulation process. Copulatory tube with funnel-shaped base surrounded by flange and filamentous articulation process arising from inner side of the base; shaft arched, with tapered distal end. Accessory piece a plate with anteromedial S-shaped arm, medially looping around distal termination of the copulatory tube. Vagina not observed.

Measurements: Body 293 (250–320; n = 3) long; greatest width 66 (53–76; n = 3). Haptor 55 (43–64; n = 3) long, 67 (52–82; n = 3) wide. Anchor: total length 41 (37–44; n = 5); inner root length 13 (11–15; n = 5); outer root length 5 (4–6; n = 5); point length 12 (10–12; n = 5). Dorsal bar 29 (24–31; n = 5) long. Ventral bar 24 (21–26; n = 5) long. Hooks (I–VII) 24 (19–28; n = 5) long: pair I 22 (19–23), pair II 24 (21–28), pair III 26 (23–28), pair IV 25 (21–28), pair V 24 (22–25), pair VI 24 (22–26), pair VII 24 (21–26). MCO: total straight length 22 (20–26; n = 5); tube trace length 20 (19–21; n = 5).

Remarks: Dactylogyrus parvicirrus covers a comparatively large geographical range, having been recorded from a total of five states (including the present study) and two provinces in the United States and Canada, respectively (see Taxonomic summary). This species is easily distinguished from its North American congeners by its unique MCO, in which the accessory piece has the shape of the letter T with its stem twisted around the distal half of the copulatory tube. However, the original drawings by Seamster [78] are highly diagrammatic (probably drawn free hand instead of from a camera lucida), and, unfortunately, the type specimens probably do not exist. Although Seamster [78] indicates that cotypes were deposited in the University of Notre Dame type collection, Indiana, there is no record of them in the collection (Barbara Hellenthal, personal communication). Present respective measurements of the haptoral structures and the MCO generally correspond to those in the original description, but there are discrepancies concerning the presence/absence of the ventral bar between the current specimens and the original account of D. parvicirrus. In his description based on twelve specimens, Seamster [78] stated that the ventral bar was not observed; also, Hargis [33] did not depict the ventral bar in his drawings from specimens collected in Virginia. However, in all of the seven specimens available to us, the ventral bar was clearly visible (see Fig. 10). This is in accordance with the phase contrast microscopy observations of Mizelle and Price [54], who depicted the haptoral parts of D. parvicirrus with a ventral bar morphologically corresponding to that in our specimens. The ventral bar, if present, is differentially developed and not always clearly visible in fixed specimens of Dactylogyrus spp. (e.g., [52]). Thus, it is possible that Seamster [78] and Hargis [33] missed the presence of the ventral bar because they did not use phase contrast optics. In addition, both authors mounted their parasites in a glycerin-gelatin medium, which makes the specimens more transparent. Another possibility is that the variation in the morphology/development of the ventral bar among D. parvicirrus populations from various localities can be attributed to intraspecific variation.

The general configuration of the MCO in the current specimens corresponds well with drawings made by both Seamster [78] and Hargis [33]. The only feature by which our specimens differ from the previous illustrations is the presence of a thin filament arising from the base of the copulatory tube and articulated to the plate-like part of the accessory piece. This difference may have arisen due to the different techniques used to mount the worms by the aforementioned authors and to the fact that this structure is clearly visible only under phase contrast optics. In view of the above, we tentatively consider the specimens from N. crysoleucas collected in New York to represent D. parvicirrus. Confirmation of this species identification will depend on the collection and examination of supplementary monogenean material (morphological and DNA samples) from or near the type locality in Oklahoma.

Phylogenetic relationships and morphology of Nearctic Dactylogyrus species

A total of 28 species of Dactylogyrus (i.e., seven new and 21 previously described) parasitizing Nearctic cypriniforms were used for molecular phylogenetic reconstruction in order to investigate the link between their phylogenetic relationships and the morphological characters of the haptor and MCO. Bayesian inference and maximum likelihood analyses, based on concatenated data sets of partial 28S rDNA, partial 18S rDNA and ITS1, generated phylogenetic trees with congruent topologies; therefore, only the BI tree is presented (Fig. 11). Dactylogyrus species parasitizing Nearctic cypriniforms were positioned in two main well-supported clades (A and B). Clade A comprises 22 strictly Nearctic Dactylogyrus species and was composed of three subclades (A1–A3). Clade B includes six Nearctic Dactylogyrus species in sister position to a clade with Dactylogyrus spp. from European leuciscids and North-West African cyprinids. Strictly Nearctic species of Dactylogyrus (clade A) share the same basic MCO morphology (=nearctic type) – however, with minor modifications typical for each monophyletic group (see below). In contrast, Nearctic Dactylogyrus species forming clade B possess an MCO of diverse morphology.

Thumbnail: Figure 11 Refer to the following caption and surrounding text. Figure 11

Phylogenetic tree of 38 Dactylogyrus species from Nearctic and Palaearctic cypriniforms resulting from BI analysis. The tree is based on concatenated partial sequences of the 28S rDNA, 18S rDNA, and ITS1 regions. Numbers along branches indicate posterior probabilities and bootstrap values resulting from BI and ML analyses, respectively. Only values >0.70 for BI and >50% for ML are shown. The new species of Dactylogyrus are highlighted in bold.

The first subclade (A1) was well-supported by both BI and ML analyses and includes nine species of Dactylogyrus parasitizing fish species of Pogonichthyinae. Dactylogyrus lachneri from N. biguttatus is in basal position to the remaining species of this subclade, followed by D. venusti from C. venusta, and a group comprising seven species of Dactylogyrus from hosts representing four different genera (Cyprinella, Luxilus, Notropis, and Pimephales, see Fig. 11). Although the phylogenetic relationships among the seven species are mostly either weakly resolved or unresolved, all of them share similar morphology with respect to their haptoral structures (see D. cornifrons n. sp. for example, Fig. 3). These are characterized by (i) anchors with moderately developed roots, an elongate shaft having a median constriction, and a well-differentiated point forming an acute angle with the shaft; (ii) a dorsal bar that is straight or slightly bent posteriorly, with slightly enlarged ends; and (iii) an inverted V-shaped ventral bar with an anteromedial knob. Unlike D. venusti, which possesses the same haptoral configuration as the seven species, D. lachneri clearly differs from the remaining species in subclade A1 by a saddle-shaped ventral bar lacking an anteromedial knob. All Dactylogyrus species representing subclade A1 share a similar morphology of the MCO (Fig. 12), i.e., a relatively simple copulatory tube supported by a bifurcated accessory piece, but there are group-forming differences in features concerning the copulatory tube. As for the base of the copulatory tube, in four species (D. arcus, D. cornifrons n. sp., D. lachneri, and D. venusti), the flange surrounding the base opening protrudes into an anteriorly directed heel, while in the other species the heel is lacking. The shape of the copulatory tube of the species belonging to subclade A1 varies from straight (D. bifurcatus) through arched (D. arcus, D. bulbus, D. cloutmani n. sp., D. cornifrons n. sp., D. lachneri, D. simplexus, and D. venusti) to sinuous (D. ornatus). The last differences concern the form of the distal termination of the copulatory tube, which may be slightly enlarged or flared (D. arcus, D. bulbus, D. cornifrons n. sp., D. simplexus, D. venusti), tapering (D. cloutmani n. sp., D. ornatus) or diagonally truncated (D. bifurcatus, D. lachneri).

Thumbnail: Figure 12 Refer to the following caption and surrounding text. Figure 12

Drawings of the MCOs taken from hologenophores of Dactylogyrus spp. included in subclade A1 of the phylogenetic tree (Fig. 11). Dactylogyrus arcus ex Luxilus chrysocephalus isolepis (Arkansas), D. bifurcatus ex Pimephales notatus (Arkansas), D. bulbus ex Luxilus c. isolepis (Arkansas), D. cloutmani n. sp. ex Luxilus c. isolepis (Arkansas), D. cornifrons n. sp. ex Cyprinella venusta (Mississippi), D. lachneri ex Nocomis biguttatus (Wisconsin), D. ornatus ex Notropis petersoni (Mississippi), D. simplexus ex P. notatus (Arkansas), D. venusti ex C. venusta (Mississippi).

The second subclade (A2) is strongly supported by posterior probabilities (PP) and bootstrap (BP) values from BI and ML analyses, respectively, and comprises five Dactylogyrus species parasitizing five species of Pogonichthyinae, each representing a different genus (i.e., Clinostomus, Luxilus, Notropis, Opsopoeodus, and Rhinichthys). All of these Dactylogyrus species share similar haptoral structures (see D. perlus for example, Fig. 4), i.e., anchors with a point having a recurved tip and forming an approximate right angle with a relatively short shaft, a broadly V-shaped dorsal bar with a medial membrane, and a straight vestigial ventral bar with a slight medial expansion. However, in D. rhinichthius, the ventral bar is absent and the dorsal bar is straight rather than V-shaped. Dactylogyrus spp. included in subclade A2 share similar morphology of the MCO (Fig. 13) with D. lachneri (with a small modification of the left ramus) and some species in the neighboring subclade A3 (i.e., D. aviunguis and D. chrosomi). The MCO is characterized by an accessory piece medially bifurcated into two unequal rami and a copulatory tube having: (i) a relatively robust base anteriorly enlarged into a heel, (ii) an almost straight to arched shaft, and (iii) a diagonally truncated distal end.

Thumbnail: Figure 13 Refer to the following caption and surrounding text. Figure 13

Drawings of the MCOs taken from hologenophores of Dactylogyrus spp. included in subclade A2 of the phylogenetic tree (Fig. 11). Dactylogyrus boopsi ex Notropis telescopus (Arkansas), D. confusus ex Clinostomus elongatus (Wisconsin), D. opsopoeodi ex Opsopoeodus emiliae (Mississippi), D. perlus ex Luxilus chrysocephalus isolepis (Arkansas), D. rhinichthius ex Rhinichthys atratulus (Wisconsin).

The third well-supported subclade (A3) includes Dactylogyrus species of Leuciscidae and Catostomidae and is subdivided into two monophyletic groups A3.1 and A3.2. Group A3.1 comprises three Dactylogyrus spp. (D. atromaculatus, D. mcallisteri n. sp., and D. attenuatus) from S. atromaculatus (Leuciscidae, Plagopterinae) (=A3.1a) and two Dactylogyrus spp. (D. chieni n. sp. and D. haneki n. sp.) from Hypentelium nigricans (Catostomidae) (=A3.1b). These two monophyletic subgroups are morphologically well separated by both haptoral and reproductive hard structures (Fig. 14). Species from S. atromaculatus (A3.1a) are characterized by anchors with an evenly curved shaft and point, a straight dorsal bar with ends bevelled inwards, and a vestigial ventral bar with an anteromedial expansion (see Fig. 5); the MCO is characterized by (i) a copulatory tube with a base lacking an anteriorly directed heel and a short, slightly-arched shaft with a diagonally truncated distal end, and by (ii) a medially bifurcated accessory piece with the right ramus bearing a plate passing diagonally across the base of the accessory piece (less developed in D. attenuatus). The sister relationship of D. atromaculatus and D. mcallisteri n. sp. is supported by both haptoral and MCO similarities (see Remarks on D. mcallisteri n. sp.). Species from H. nigricans (A3.1b), D. chieni n. sp. and D. haneki n. sp., differ from the previous subgroup (A3.1a) by the shape of the anchors, which are of the same type as in most species forming subclade A1, by the morphology of the MCO, and by the presence of a sclerotized vagina. The huge elongate base, short arched shaft, and a broadly V-shaped accessory piece represent MCO characters by which Dactylogyrus spp. from H. nigricans clearly differ from those parasitizing Nearctic leuciscids. The well-supported monophyletic group A3.2 comprises D. aviunguis from N. biguttatus (Pogonichthyinae) and D. chrosomi from C. neogaeus (Laviniinae) (PP = 0.94; BP = 90), and D. aduncus n. sp. from C. spadiceum (Pogonichthyinae). Although D. aviunguis and D. chrosomi parasitize hosts of different subfamilies, these species share similar MCOs with Dactylogyrus spp. included in subclade A2.

Thumbnail: Figure 14 Refer to the following caption and surrounding text. Figure 14

Drawings of the MCOs taken from hologenophores of Dactylogyrus spp. included in subclade A3 of the phylogenetic tree (Fig. 11). Dactylogyrus aduncus n. sp. ex Campostoma spadiceum (Arkansas), D. atromaculatus ex Semotilus atromaculatus (Wisconsin), D. attenuatus ex S. atromaculatus (Wisconsin), D. aviunguis from Nocomis biguttatus (Wisconsin), D. chieni n. sp. ex Hypentelium nigricans (Arkansas), D. chrosomi ex Chrosomus neogaeus (Wisconsin), D. haneki n. sp. ex H. nigricans (Arkansas), D. mcallisteri n. sp. ex S. atromaculatus (Arkansas).

In the second main clade (B), species of Dactylogyrus parasitizing Nearctic leuciscids form a monophyletic group that is sister to Dactylogyrus spp. from European leuciscids and North-West African cyprinids. The phylogenetic analyses strongly support the phylogenetic proximity of two morphologically close species, namely D. cheloideus and D. fimbratus n. sp., both parasitizing species of Rhinichthys. However, their phylogenetic position to other Dactylogyrus spp. in clade B is weakly resolved only by ML analysis. Dactylogyrus parvicirrus from N. crysoleucas, the only host species representing Leuciscinae in the Nearctic region, appears to be sister to the remaining species in clade B that parasitize mostly Pogonichthyinae (with the exception of D. eos from C. neogaeus (Laviniinae)). The phylogenetic relationships among D. flagristylus, D. eos, and D. pectenatus were moderately or weakly supported by PP and BP in our analyses, which is consistent with the dissimilarity in the morphology of the hard structures (both haptoral and reproductive) of these species (Fig. 15).

Thumbnail: Figure 15 Refer to the following caption and surrounding text. Figure 15

Drawings of the MCOs taken from hologenophores of Dactylogyrus spp. included in clade B of the phylogenetic tree (Fig. 11). Dactylogyrus cheloideus ex Rhinichthys atratulus (Wisconsin), D. eos ex Chrosomus neogaeus (Wisconsin), D. fimbratus n. sp. ex Rhinichthys cataractae (New York), D. flagristylus ex Nocomis biguttatus (Wisconsin), D. parvicirrus ex Notemigonus crysoleucas (New York), D. pectenatus ex Pimephales promelas (Wisconsin).

Discussion

Prior to the present study, 132 nominal species of Dactylogyrus had been recorded from 113 species of native cypriniform fishes in North America [19, 20, 41]. The seven new species described herein raise the number of formally described Dactylogyrus species to 139 and the number of known host species for Dactylogyrus spp. to 114. Given that more than half of North American species of Dactylogyrus are strict specialists parasitizing a single host species (61%; [41]), this number is undoubtedly an underestimate of the total diversity of these parasites, as more than 390 species of cypriniform fishes are currently known on this continent. Unfortunately, however, the descriptions of many of the previously described Dactylogyrus species from cypriniforms in North America are based on schematic illustrations and their taxonomic quality tends to be low. This makes species identification difficult and thereby increases the risk of duplicate descriptions, which indicates that some Dactylogyrus species may end up being synonyms.

The haptoral as well as reproductive hard structures in Dactylogyrus species express different morphological types, on the basis of which species of the genus may be grouped. These groups are often defined on the basis of the morphological type of one of these structures (e.g., by anchor shape) and cannot be separated using all structures at once [3, 5, 66, 71, 80]. Given that the structural morphology and configuration of the attachment organ (i.e., the haptor) are supposed to play an important role in monogenean specialization and adaptation to host species [42, 75, 79, 80], these morphological groups may be viewed as phylogenetic units connected with the host specificity of these parasites. However, the huge diversity in both haptoral and reproductive structures results in the categorization of many morphological groups in Dactylogyrus species (see [66]) and it is difficult to determine which structural characters indicate the degree of relatedness between different species of the genus. Moreover, as phenotypes are influenced by environmental factors as well as by genes, some morphological characters in Dactylogyrus species may undergo convergent evolution in divergent lineages [5, 66, 80]. Compared to the Palaearctic region, where many morphological groups of Dactylogyrus have been recognized on the basis of the morphological type of one particular structure [5, 66, 71], very little is known about morphological grouping within Nearctic species of Dactylogyrus. Chien [1012] divided fifteen species of Dactylogyrus from Nocomis spp. into four groups: (i) the reciprocus group (D. effusus, D. lachneri, and D. reciprocus); (ii) the bellicus group (D. ancylostylus, D. asper, D. aviunguis, D. latirictus, D. leptostylus, D. megastylus, D. millieae, and D. mississippiensis); (iii) the limulus group (D. flagristylus, D. limulus, and D. malleolus), and (iv) the mollis group (D. mollis). He defined the above groups on the basis of a combination of morphological features, mainly those concerning the haptoral structures and MCO.

In the present study, 28 Dactylogyrus species parasitizing mostly species of Nearctic Leuciscidae and forming two phylogenetic clades with different origins [82] are divided into two main morphological groups on the basis of the MCO. Strictly Nearctic species of Dactylogyrus (clade A) share the same basic MCO morphology (=the nearctic morphological type) – however, with minor modifications typical of each phylogenetic subgroup. In contrast, Nearctic species forming a sister clade (clade B) to Palaearctic species of Dactylogyrus possess an MCO of diverse morphology. The “nearctic” type of MCO basically corresponds to that of D. intermedius and D. vastator (i.e., “anchoratus” type in [66]), two species forming a basal group to all Nearctic Dactylogyrus spp. according to currently available DNA sequences, and parasitizing cyprinids with a Euro-Asian distribution ([82], present study). The largely accepted view is that fishes of Cyprinoidei originated in the Oriental region [2, 6]. Fossil records together with results of phylogenetic analyses showing the Far East Asian Pseudaspininae to be a sister group to all remaining leuciscids suggest a long history of cyprinoids in eastern Asia, and support the hypothesis that ancestral Asian leuciscids colonized North America via the Bering Land Bridge during the mid-Oligocene [8, 77]. The Asian origin of the clade comprising Dactylogyrus spp. from strictly Nearctic leuciscids (plus two Dactylogyrus spp. from catostomids) was also supported by the mapping of fish subfamilies into Dactylogyrus phylogeny by Šimková et al. [82], where cyprinids (with likely Asian origin) were shown as a potential ancestral host group for this parasite clade. Considering all the above, the “anchoratus” type of MCO (as defined by Pugachev et al. [66]) may represent the ancestral state for one of the main phylogenetic lineages of Dactylogyrus spp. parasitizing Nearctic cypriniforms (i.e., species of clade A in the present study). This can be further supported by the fact that the MCO of the “anchoratus” type occurs in D. yinwenyingae Gussev, 1962, a species hitherto reported from nasal cavities of many cypriniforms (including pseudaspinins) from the Danube River up to the Amur River (see [66]) and water reservoirs of North America (=Aplodiscus nasalis; [72]). Finally, it is equally important to mention that the “nearctic” or “anchoratus” type of MCO can be observed in species of Pellucidhaptor Price & Mizelle, 1964. Species of this genus were found on the skin and in nasal cavities of catostomids, rarely leuciscids (Leuciscinae, Phoxininae, Pseudaspininae), from the Nearctic region (19 species) and the Palaearctic region (4 species) [41]. The haptoral configuration as well as the internal features of Pellucidhaptor spp. correspond to Dactylogyrus spp. with one haptoral bar (e.g., D. intermedius, D. vastator, and D. yinwenyingae). The unclear morphological boundaries between these two genera together with the shared host spectrum may indicate an uncertain generic status for Pellucidhaptor. Thus, it would be interesting to investigate the phylogenetic position of Pellucidhaptor spp. within dactylogyrids parasitizing cypriniforms, especially their position to species of Dactylogyrus.

Unlike strictly Nearctic Dactylogyrus spp. (clade A), the Nearctic species forming a sister clade to European and North-West African Dactylogyrus spp. (clade B) exhibit variable morphologies of the MCOs, with the exception of D. cheloideus and D. fimbratus n. sp. from Rhinichthys spp. These two sister species share a similar morphology of both the MCO and haptoral structures, and, surprisingly, a similar MCO morphology with European Dactylogyrus tincae Gussev, 1968 and Dactylogyrus triappendixis Wierzbicka & Gronet, 1997 (for which molecular data are not available) from Tinca tinca (Linnaeus) (see [66]), an enigmatic species with a native Eurasian distribution [9, 28]. The European origin of Nearctic Dactylogyrus spp. forming clade B was previously suggested by Šimková et al. [82]. However, the basic MCO morphology of all four species corresponds to the “nearctic” (=anchoratus) type, the type characteristic of species of clade A, with likely Asian origin [82]. It is possible that the MCO of the “nearctic” type evolved convergently in Dactylogyrus spp. within both Nearctic lineages (i.e., within clade A as well as in D. cheloideus and D. fimbratus n. sp. within clade B). However, there is also the possibility that the “nearctic” (=anchoratus) type is, in fact, the ancestral state of the MCO for Dactylogyrus spp. parasitizing European, West-African, and Nearctic cypriniforms, and that different MCO types in species of clade B developed after the divergence from a common ancestor (probably originating in the Oriental region) during the historical dispersion of Asian cyprinoids in Eurasia [8, 77].

Comparing the phylogenetic reconstruction and the morphology of the haptoral structures, Dactylogyrus species with the same configuration and similarly shaped haptoral structures tended to form monophyletic groups. This supports previous studies showing that haptoral structures reflect a phylogenetic signal and represent important tools for resolving monogenean phylogeny [4, 5, 48, 80, 86]. In the case of Dactylogyrus spp. parasitizing leuciscids of highly diversified Pogonichthyinae, two large morphological groups were recognized (corresponding to subclade A1 and subclade A2), each clearly defined by the shapes of the anchors and both bars. The third group sharing the same type of haptoral configuration consists of only two species, D. cheloideus and D. fimbratus n. sp., positioned within clade B. The remaining Dactylogyrus spp. from pogonichthyins have a different position (D. aduncus n. sp. D. aviunguis, and D. lachneri in clade A) or a poorly resolved position (D. flagristylus and D. pectenatus in clade B) in the phylogenetic tree, and possess different haptoral configurations. This seems to indicate that closely related Dactylogyrus spp. possess similar haptors not because they infect closely related host species (in this case, leuciscids of Pogonichthyinae) but because the same morphology of the haptor is shared from their common ancestor. It is generally accepted that the morphology of the haptoral structures determines specific gill microhabitat positions of monogenean species within a single host, and that coexisting species occupying the same niche should differ in their MCOs to strengthen reproductive barriers and thereby prevent hybridization through niche segregation (e.g. [56, 74, 79]). Alternatively, Vignon et al. [86] hypothesized that nonhomoplastic (i.e., correlated with phylogeny) evolution of the haptoral sclerites may favor host-switch among closely related species in order to avoid hybridization. Similar patterns of host-parasite associations were observed in some cases of Dactylogyrus spp. investigated in the present study. Four species, D. arcus, D. bulbus, D. cloutmani n. sp., and D. perlus, co-occurred in L. chrysocephalus isolepis in Arkansas. The first three species share the same haptoral configuration as representatives of subclade A1, but they differ in the details of their MCOs (see Fig. 12). The fourth species, D. perlus (Fig. 4), clearly differs from the above three species by its distinctive morphology of the haptoral structures (i.e., typical for species of subclade A2), and its presence on L. chrysocephalus isolepis likely represents host-switch. Dactylogyrus species forming subclade A2 show higher similarities in MCO morphology (see Fig. 13) compared to those of A1 – so much so that some of them appear to form complexes of species and their delimitation is controversial, as suggested for the D. perlus (=banghami) complex of species [16, 18, 32] reported from a variety of leuciscid hosts in North America [35]. Similarly, Cloutman et al. [20] raised the question of whether D. crucis and D. lythruri (i.e., species with similar morphology to those in subclade A2) parasitizing the gills of seven and eight species of Lythrurus, respectively, display congeneric rather than strict host specificity or represent complexes of cryptic species. In the case of three Dactylogyrus species from S. atromaculatus (Plagopterinae) (group A3.1a) and two Dactylogyrus spp. from H. nigricans (Catostomidae) (group A3.1b), very similar haptoral and MCO morphologies for the respective groups were observed. The co-occurrence of Dactylogyrus spp. on one host species, as mentioned above, could indicate the same genetic/morphological underpinning of features leading to reproductive isolation and therefore parallel speciation among Dactylogyrus spp. from the respective hosts.

Conclusion

In light of the above, further investigations based on precise morphological description, in particular detailed illustrations of the taxonomically important structures, and molecular characterization of the remaining species of Dactylogyrus should be performed to allow a more complete phylogenetic analysis of this diverse group of parasites. Many earlier taxonomic works on Dactylogyrus spp. in North America are based on schematic illustrations of the sclerotized parts of the attachment and reproductive organs, which probably led to poor differential diagnoses resulting in many errors in species identification, and even currently make species identification difficult. In this paper, seven new and 21 known species of Dactylogyrus previously molecularly determined are described and/or morphologically vouchered together with illustrations of the MCOs taken from the respective hologenophores. This study shows that a relatively simple accessory piece bifurcated into two unequal rami (right ramus is usually shorter and possesses lightly sclerotized pieces) should be considered the main synapomorphy of the phylogenetically strict Nearctic species of Dactylogyrus. Detailed illustration of the MCO is often the only tool for the differentiation of closely related species. Dactylogyrus spp. with the same configuration and similarly shaped haptoral structures tend to form monophyletic groups. The present results are a basic but important step to further ecological and evolutionary studies on this multi-continental group of monogenean parasites, including their host specificity and host-parasite co-evolutionary interactions.

Acknowledgments

We are grateful to our US colleagues for providing the facilities and logistic support for field trips, and also for fish sampling and fish identification: Chris T. McAllister (Science and Mathematics Division, Eastern Oklahoma State College, Idabel, Oklahoma), Stephen S. Curran and the late Robin M. Overstreet (Gulf Coast Research Laboratory, Ocean Springs, Mississippi), Florian B. Reyda (State University of New York, Oneonta College, Oneonta, New York), and Anindo Choudhury (Division of Natural Sciences, St. Norbert College, De Pere, Wisconsin). Special thanks also go to Donald G. Cloutman (Burdett, Kansas) for his enthusiasm and help with parasite determination during fieldwork. We are also grateful to our Czech colleagues Tomáš Scholz and Roman Kuchta (Institute of Parasitology, Biology Centre of the Czech Academy of Science) for their help during fish dissection and parasite collection. We are thankful to the curators of the helminthological collection at the Smithsonian’s National Museum of Natural History, Anna J. Phillips and Adam Stergis (NMNH Department of Invertebrate Zoology, Suitland, Maryland), for lending us the monogenean paratypes; Barbara Hellenthal (Museum of Biodiversity and Greene-Nieuwland Herbarium, Department of Biological Sciences, University of Notre Dame, Notre Dame, Indiana) kindly provided information on paratypes of monogeneans collected by Aaron Seamster. We also thank Matthew Nicholls for the English revision of the final draft, and the anonymous reviewers.

This study was funded by the Ministry of Education, Youth and Sports of the Czech Republic, project no. LTAUSA18010 (for years 2019–2022) and project no. LUAUS23080 (for year 2023).

References

  1. Bagley JC, Mayden RL, Harris PM. 2018. Phylogeny and divergence times of suckers (Cypriniformes: Catostomidae) inferred from Bayesian total-evidence analyses of molecules, morphology, and fossils. PeerJ, 6, e5168. [CrossRef] [PubMed] [Google Scholar]
  2. Bănărescu P. 1972. The zoogeographical position of the East Asian freshwater fish fauna. Revue Roumaine de Biologie – Série de Biologie, 17, 315–323. [Google Scholar]
  3. Benovics M, Desdevises Y, Vukić J, Šanda R, Šimková A. 2018. The phylogenetic relationships and species richness of host-specific Dactylogyrus parasites shaped by the biogeography of Balkan cyprinids. Scientific Reports, 8, 13006. [CrossRef] [PubMed] [Google Scholar]
  4. Benovics M, Vukić J, Šanda R, Rahmouni I, Šimková A. 2020. Disentangling the evolutionary history of peri-Mediterranean cyprinids using host-specific gill monogeneans. International Journal for Parasitology, 50, 969–984. [CrossRef] [PubMed] [Google Scholar]
  5. Benovics M, Nejat F, Abdoli A, Šimková A. 2021. Molecular and morphological phylogeny of host-specific Dactylogyrus parasites (Monogenea) sheds new light on the puzzling Middle Eastern origin of European and African lineages. Parasites & Vectors, 14, 372. [CrossRef] [PubMed] [Google Scholar]
  6. Briggs J. 1979. Ostariophysan zoogeography: an alternative hypothesis. Copeia, 1, 111–118. [CrossRef] [Google Scholar]
  7. Brooks DR, Hoberg EP. 2000. Triage for the biosphere: the need and rationale for taxonomic inventories and phylogenetic studies of parasites. Comparative Parasitology, 67, 1–25. [Google Scholar]
  8. Cavender TM. 1991. The fossil record of the Cyprinidae, in Cyprinid fishes: Systematics, biology and exploitation (Vol. 3). Winfield IJ, Nelson JS, Editors. Fish & Fisheries Series, Springer: Netherlands. p. 34–54. [CrossRef] [Google Scholar]
  9. Chen W-J, Mayden RL. 2009. Molecular systematics of the Cyprinoidea (Teleostei: Cypriniformes), the world’s largest clade of freshwater fishes: further evidence from six nuclear genes. Molecular Phylogenetics and Evolution, 52, 544–549. [CrossRef] [PubMed] [Google Scholar]
  10. Chien SM. 1971. Dactylogyrids from North American cyprinids of the genus Nocomis. The reciprocus species group. Journal of Parasitology, 57, 1211–1214. [CrossRef] [Google Scholar]
  11. Chien SM. 1974. Dactylogyrids from North American cyprinids of the genus Nocomis. The bellicus group. Journal of Parasitology, 60, 585–594. [CrossRef] [Google Scholar]
  12. Chien SM. 1974. Dactylogyrids from North American cyprinids of the genus Nocomis: The limulus and the mollis groups. Journal of Parasitology, 60, 773–776. [CrossRef] [Google Scholar]
  13. Cloutman DG. 1974. Monogenean and copepod parasites of fishes from the Smoky Hill River, Ellis County, Kansas. Transactions of the Kansas Academy of Science, 77, 225–230. [CrossRef] [Google Scholar]
  14. Cloutman DG. 1976. Parasitism in relation to taxonomy of the sympatric sibling species of stonerollers, Campostoma anomalum pullum (Agassiz) and C. oligolepis Hubbs and Greene, in the White River, Arkansas. Southwestern Naturalist, 21, 67–70. [CrossRef] [Google Scholar]
  15. Cloutman DG. 1987. Dactylogyrus (Monogenea: Dactylogyridae) from Hybopsis and Notropis (Cyprinella) (Pisces: Cyprinidae) from the Tennessee River drainage, with descriptions of three new species and remarks on host relationships. Proceedings of the Helminthological Society of Washington, 54, 78–83. [Google Scholar]
  16. Cloutman DG. 1988. Dactylogyrus (Monogenea: Dactylogyridae) from seven species of Notropis (Pisces: Cyprinidae) from the Tennessee River drainage: descriptions of four new species and remarks on host relationships. Proceedings of the Helminthological Society of Washington, 55, 214–223. [Google Scholar]
  17. Cloutman DG. 1994. Dactylogyrus boopsi sp. n. (Monogenea: Dactylogyridae) from the bigeye shiner, Notropis boops Gilbert (Pisces: Cyprinidae). Journal of the Helminthological Society of Washington, 61, 219–220. [Google Scholar]
  18. Cloutman DG, Rogers WA. 2005. Determination of the Dactylogyrus banghami complex (Monogenea: Dactylogyridae) from North American Gulf of Mexico coastal drainages with descriptions of three new species. Comparative Parasitology, 72, 10–16. [CrossRef] [Google Scholar]
  19. Cloutman DG, McAllister CT, Robison HW. 2020. Dactylogyrus pisolabrae n. sp. (Monogenoidea: Dactylogyridae) parasitizing the pealip redhorse, Moxostoma pisolabrum (Teleostei: Catostomidae), from Oklahoma, USA. Journal of Parasitology, 106, 53–55. [CrossRef] [PubMed] [Google Scholar]
  20. Cloutman DG, Adrian AB, McAllister CT, Stallsmith BW, Fayton TJ, Robison HW. 2020. Revision of monogeneans parasitising Lythrurus (Cypriniformes: Leuciscidae) in eastern USA, with description of Dactylogyrus lythruri sp. n. and new records of Dactylogyrus crucis Rogers, 1967 (Monogenoidea: Dactylogyridae). Folia Parasitologica, 67, 011. [CrossRef] [Google Scholar]
  21. Cone DK. 1980. The Monogenea of some freshwater fishes in New Brunswick, Canada. Journal of Parasitology, 66, 178–180. [CrossRef] [Google Scholar]
  22. Dechtiar AO. 1972. Parasites of fish from Lake of the Woods, Ontario. Journal of the Fisheries Research Board of Canada, 29, 275–283. [CrossRef] [Google Scholar]
  23. Dechtiar AO, Collins J, Reckhan J. 1971. Survey of the parasite fauna of Lake Huron fishes, 1961 to 1971, in Parasites of fishes in the Canadian waters of the Great Lakes. Technical Report 51. Nepszy SJ, Editor. Great Lakes fishery commission: Ann Arbor, Michigan. p. 19–48. [Google Scholar]
  24. Dechtiar AO, Maclean J, Nepszy S. 1989. Parasites of fishes from Algonquin Park lakes. Ontario Fisheries Technical Report Series, 29, 19. [Google Scholar]
  25. Ergens R. 1969. The suitability of ammonium picrate-glycerine in preparing slides of lower Monogenoidea. Folia Parasitologica, 16, 320. [Google Scholar]
  26. Fricke R, Eschmeyer W, Van der LR. 2022. Eschmeyer’s catalog of fishes: genera, species, references. Electronic version accessed 10 Jun 2022. [Google Scholar]
  27. Froeschke G, von der Heyden S. 2014. A review of molecular approaches for investigating patterns of coevolution in marine host-parasite relationships. Advances in Parasitology, 84, 209–252. [CrossRef] [PubMed] [Google Scholar]
  28. Froese R, Pauly D. 2022. FishBase. World Wide Web electronic publication. www.fishbase.org, version (08/2022). [Google Scholar]
  29. Gibson D. 2022. World list of Monogenea, in Catalogue of life checklist (ver. (12/2022)), Bánki O, Roskov Y, Döring M, Ower G, Vandepitte L, Hobern D, Remsen D, Schalk P, DeWalt RE, Keping M, Miller J, Orrell T, Aalbu R, Adlard R, Adriaenssens EM, Aedo C, Aescht E, Akkari N, Alexander S, et al., Editors. Available at: https://doi.org/10.48580/dfqz-3cv [Google Scholar]
  30. Gibson DI, Timofeeva TA, Gerasev PI. 1996. A catalogue of the nominal species of the monogenean genus Dactylogyrus Diesing, 1850 and their host genera. Systematic Parasitology, 35, 3–48. [CrossRef] [Google Scholar]
  31. Hanek G, Fernando CH. 1972. Monogenetic trematodes from the Bay of Quinte area, Ontario. IV. Genus Dactylogyrus Diesing, 1850, with provisional host-parasite and parasite-host lists. Canadian Journal of Zoology, 50, 1313–1317. [CrossRef] [PubMed] [Google Scholar]
  32. Hanek G, Molnár K, Fernando CH. 1975. New and previously known Dactylogyrus spp. from southern Ontario fishes. Journal of Parasitology, 61, 421–426. [CrossRef] [Google Scholar]
  33. Hargis WJ. 1953. Monogenetic trematodes of Westhampton Lake fishes. III. Part 1. Comparative morphology of the species encountered. Journal of Parasitology, 39, 88–105. [CrossRef] [Google Scholar]
  34. Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS. 2018. UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution, 35, 518–522. [CrossRef] [PubMed] [Google Scholar]
  35. Hoffman GL. 1999. Parasites of North American freshwater fishes. Cornell University Press: Ithaca and London. [CrossRef] [Google Scholar]
  36. Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods, 14, 587–589. [CrossRef] [PubMed] [Google Scholar]
  37. Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution, 30, 772–780. [CrossRef] [Google Scholar]
  38. Katoh K, Rozewicki J, Yamada KD. 2019. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics, 20, 1160–1166. [CrossRef] [PubMed] [Google Scholar]
  39. Kritsky DC, Leiby PD, Kayton RJ. 1977. Dactylogyrus unguiformis sp. n. (Monogenea) from the mottled sculpin, Coitus bairdi Girard, in Idaho, with some taxonomic considerations in the genus Dactylogyrus. Proceedings of the Helminthological Society, 44, 141–147. [Google Scholar]
  40. Kritsky D, Boeger W, Thatcher V. 1985. Neotropical Monogenea. 7. Parasites of the pirarucu, Arapaima gigas (Cuvier), with discription of two new species and redescription of Dawestrema cycloancistrium Price and Nowlin, 1967 (Dactylogyridae: Ancyrocephalinae). Proceedings of the Biological Society of Washington, 98, 321–331. [Google Scholar]
  41. Kuchta R, Řehulková E, Francová K, Scholz T, Morand S, Šimková A. 2020. Diversity of monogeneans and tapeworms in cypriniform fishes across two continents. International Journal for Parasitology, 50, 771–786. [CrossRef] [PubMed] [Google Scholar]
  42. Lambert A, El Gharbi S. 1995. Monogenean host specificity as a biological and taxonomic indicator for fish. Biological Conservation, 72, 227–235. [CrossRef] [Google Scholar]
  43. Machordom A, Doadrio I. 2001. Evidence of a cenozoic betic–kabilian connection based on freshwater fish phylogeography (Luciobarbus, Cyprinidae). Molecular Phylogenetics and Evolution, 18, 252–263. [CrossRef] [PubMed] [Google Scholar]
  44. Malmberg G. 1957. Om förekomsten av Gyrodactylus på svenske fiskar. Skrifter Utgivna Av Södra Sveriges Fiskeriförening, Årsskrift, 1956, 19–76. (In Swedish, species descriptions and summary in English). [Google Scholar]
  45. Mayden RL, Chen W-J, Bart HL, Doosey MH, Simons AM, Tang KL, Wood RM, Agnew MK, Yang L, Hirt MV, Clements MD, Saitoh K, Sado T, Miya M, Nishida M. 2009. Reconstructing the phylogenetic relationships of the earth’s most diverse clade of freshwater fishes-order Cypriniformes (Actinopterygii: Ostariophysi): a case study using multiple nuclear loci and the mitochondrial genome. Molecular Phylogenetics and Evolution, 51, 500–514. [CrossRef] [PubMed] [Google Scholar]
  46. Mayes MA. 1977. New species of Gyrodactylus and Dactylogyrus (Trematoda: Monogenea) from fishes of Nebraska. Journal of Parasitology, 63, 805–809. [CrossRef] [Google Scholar]
  47. McAllister C, Choudhury A, Fayton T, Cloutman D, Bursey C, Robison H, Whipps C, Scholz T. 2021. Parasites of western creek chubsucker Erimyzon claviformis (Cypriniformes: Catostomidae) from Arkansas and Oklahoma, U.S.A. Comparative Parasitology, 88(1), 113–129. [Google Scholar]
  48. Mendlová M, Desdevises Y, Civáňová K, Pariselle A, Šimková A. 2012. Monogeneans of West African cichlid fish: Evolution and cophylogenetic interactions. PLoS One, 7, e37268. [CrossRef] [PubMed] [Google Scholar]
  49. Mizelle JD. 1936. New species of trematodes from the gills of Illinois fishes. American Midland Naturalist, 17, 785–806. [CrossRef] [Google Scholar]
  50. Mizelle JD. 1937. Ectoparasites of the blunt-nosed minnow (Hyborhynchus notatus). American Midland Naturalist, 18, 612–621. [CrossRef] [Google Scholar]
  51. Mizelle JD. 1938. New species of monogenetic flukes from Illinois fishes. American Midland Naturalist, 19, 465–470. [CrossRef] [Google Scholar]
  52. Mizelle JD, Donahue MA. 1944. Studies on monogenetic trematodes XI. Dactylogyridae from Algonquin Park fishes. American Midland Naturalist, 31, 600–624. [CrossRef] [Google Scholar]
  53. Mizelle JD, Klucka AR. 1953. Studies on monogenetic trematodes. XIV. Dactylogyridae from Wisconsin fishes. American Midland Naturalist, 49, 720–733. [CrossRef] [Google Scholar]
  54. Mizelle JD, Price CE. 1963. Additional haptoral hooks in the genus Dactylogyrus. Journal of Parasitology, 49, 1028–1029. [CrossRef] [Google Scholar]
  55. Monaco LH, Mizelle JD. 1955. Studies on monogenetic trematodes. XVII. The genus Dactylogyrus. American Midland Naturalist, 53, 455–477. [CrossRef] [Google Scholar]
  56. Morand S, Šimková A, Matějusová I, Plaisance L, Verneau O, Desdevises Y. 2002. Investigating patterns may reveal processes: evolutionary ecology of ectoparasitic monogeneans. International Journal for Parasitology, 32, 111–119. [CrossRef] [PubMed] [Google Scholar]
  57. Mueller J. 1938. Additional species of North American Gyrodactyloidea (Trematoda). American Midland Naturalist, 19, 220–235. [CrossRef] [Google Scholar]
  58. Nadler SA, Pérez-Ponce de León G. 2011. Integrating molecular and morphological approaches for characterizing parasite cryptic species: implications for parasitology. Parasitology, 138, 1688–1709. [CrossRef] [PubMed] [Google Scholar]
  59. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution, 32, 268–274. [CrossRef] [PubMed] [Google Scholar]
  60. Nowlin W, Price C, Schlueter E. 1967. First report of freshwater monogenetic trematodes of Texas. Texas Journal of Science, 19, 110–111. [Google Scholar]
  61. Pleijel F, Jondelius U, Norlinder E, Nygren A, Oxelman B, Schander C, Sundberg P, Thollesson M. 2008. Phylogenies without roots? A plea for the use of vouchers in molecular phylogenetic studies. Molecular Phylogenetics and Evolution, 48, 369–371. [CrossRef] [PubMed] [Google Scholar]
  62. Poulin R. 2002. The evolution of monogenean diversity. International Journal for Parasitology, 32, 245–254. [CrossRef] [PubMed] [Google Scholar]
  63. Poulin R, Morand S. 2000. The diversity of parasites. Quarterly Review of Biology, 75, 277–293. [CrossRef] [PubMed] [Google Scholar]
  64. Poulin R, Leung TLF. 2010. Taxonomic resolution in parasite community studies: are things getting worse? Parasitology, 137, 1967–1973. [CrossRef] [PubMed] [Google Scholar]
  65. Price C. 1967. A revised definition of the monogenetic trematode genus Dactylogyrus, with descriptions of four new species. Proceedings of the Helminthological Society of Washington, 34, 117–124. [Google Scholar]
  66. Pugachev O, Gerasev P, Gussev A, Ergens R, Khotenowsky I. 2009. Guide to Monogenoidea of freshwater fish of Palaearctic and Amur Regions. Ledizione-Ledi Publishing: Milan. [Google Scholar]
  67. Rahmouni I, Řehulková E, Pariselle A, Rkhami O, Šimková A. 2017. Four new species of Dactylogyrus Diesing, 1850 (Monogenea: Dactylogyridae) parasitising the gills of northern Moroccan Luciobarbus Heckel (Cyprinidae): morphological and molecular characterisation. Systematic Parasitology, 94, 575–591. [CrossRef] [PubMed] [Google Scholar]
  68. Rambaut A. 2018. FigTree version 1.4.4. Available at: http://tree.bio.ed.ac.uk/software/figtree/ [Google Scholar]
  69. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. 2018. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, 67, 901–904. [CrossRef] [PubMed] [Google Scholar]
  70. Řehulková E. 2018. Basic methods to study fish parasites. Ectoparasitic helminths (Monogenea), in A guide to the parasites of African freshwater fishes, AbcTaxa. CEBioS, Royal Belgian Institute of Natural Sciences: Brussels, Belgium. p. 89–98. [Google Scholar]
  71. Řehulková E, Benovics M, Šimková A. 2020. Uncovering the diversity of monogeneans (Platyhelminthes) on endemic cypriniform fishes of the Balkan Peninsula: new species of Dactylogyrus and comments on their phylogeny and host-parasite associations in a biogeographic context. Parasite, 27, 66. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  72. Rogers WA. 1967. Studies on Dactylogyrinae (Monogenea) with descriptions of 24 new species of Dactylogyrus, 5 new species of Pellucidhaptor, and the proposal of Aplodiscus gen. n. Journal of Parasitology, 53, 501–524. [CrossRef] [Google Scholar]
  73. Rogers WA, Mizelle JD. 1966. New species of Dactylogyrinae from Alabama fishes. Journal of Parasitology, 52, 707–712. [CrossRef] [Google Scholar]
  74. Rohde K. 1979. A critical evaluation of intrinsic and extrinsic factors responsible for niche restriction in parasites. American Naturalist, 114, 648–671. [CrossRef] [Google Scholar]
  75. Rohde K. 1994. Niche restriction in parasites: proximate and ultimate causes. Parasitology, 109 Suppl., S69–S84. [CrossRef] [PubMed] [Google Scholar]
  76. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61, 539–542. [CrossRef] [PubMed] [Google Scholar]
  77. Schönhuth S, Vukić J, Šanda R, Yang L, Mayden R. 2018. Phylogenetic relationships and classification of the Holarctic family Leuciscidae (Cypriniformes: Cyprinoidei). Molecular Phylogenetics and Evolution, 127, 781–799. [CrossRef] [PubMed] [Google Scholar]
  78. Seamster A. 1948. Two new Dactylogyridae (Trematoda: Monogenea) from the golden shiner. Journal of Parasitology, 34, 111–113. [CrossRef] [Google Scholar]
  79. Šimková A, Ondračková M, Gelnar M, Morand S. 2002. Morphology and coexistence of congeneric ectoparasite species: reinforcement of reproductive isolation? Biological Journal of the Linnean Society, 76, 125–135. [Google Scholar]
  80. Šimková A, Verneau O, Gelnar M, Morand S. 2006. Specificity and specialization of congeneric monogeneans parasitizing cyprinid fish. Evolution, 60, 1023–1037. [Google Scholar]
  81. Šimková A, Benovics M, Rahmouni I, Vukić J. 2017. Host-specific Dactylogyrus parasites revealing new insights on the historical biogeography of Northwest African and Iberian cyprinid fish. Parasites & Vectors, 10, 589. [CrossRef] [PubMed] [Google Scholar]
  82. Šimková A, Řehulková E, Choudhury A, Seifertová M. 2022. Host-specific parasites reveal the history and biogeographical contacts of their hosts: the Monogenea of Nearctic cyprinoid fishes. Biology-Basel, 11, 229. [Google Scholar]
  83. Stout CC, Tan M, Lemmon AR, Lemmon EM, Armbruster JW. 2016. Resolving Cypriniformes relationships using an anchored enrichment approach. BMC Evolutionary Biology, 16, 244. [CrossRef] [PubMed] [Google Scholar]
  84. Tan M, Armbruster J. 2018. Phylogenetic classification of extant genera of fishes of the order Cypriniformes (Teleostei: Ostariophysi). Zootaxa, 4476, 6. [PubMed] [Google Scholar]
  85. Van der LR, Fricke R. 2022. Eschmeyer’s Catalog of Fishes: Family-group names. Electronic version accessed 10 Sept 2022 [Google Scholar]
  86. Vignon M, Pariselle A, Vanhove MP. 2011. Modularity in attachment organs of African Cichlidogyrus (Platyhelminthes: Monogenea: Ancyrocephalidae) reflects phylogeny rather than host specificity or geographic distribution. Biological Journal of the Linnean Society, 102, 694–706. [CrossRef] [Google Scholar]
  87. Whittington ID, Cribb BW, Hamwood TE, Halliday JA. 2000. Host-specificity of monogenean (platyhelminth) parasites: a role for anterior adhesive areas? International Journal for Parasitology, 30, 305–320. [CrossRef] [PubMed] [Google Scholar]
  88. Wood RA, Mizelle JD. 1957. Studies on monogenetic trematodes. XXI. North American Gyrodactylinae, Dactylogyrinae and a new host record for Urocleidus dispar (Mueller, 1936). American Midland Naturalist, 57, 183–202. [CrossRef] [Google Scholar]

Cite this article as: Řehulková E, Seifertová M, Francová K & Šimková A. 2023. Nearctic Dactylogyrus species (Platyhelminthes, Monogenea) parasitizing cypriniform fishes in the context of morphology and phylogeny, with descriptions of seven new species. Parasite 30, 30.

All Tables

Table 1

List of Dactylogyrus species used in phylogenetic analyses, their cypriniform host species, locality of collection, GenBank accession numbers for DNA sequences, and MNHN accession numbers for hologenophores.

All Figures

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

Sclerotized structures of Dactylogyrus aduncus n. sp. ex Campostoma spadiceum. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

In the text
Thumbnail: Figure 2 Refer to the following caption and surrounding text. Figure 2

Sclerotized structures of Dactylogyrus cloutmani n. sp. ex Luxilus chrysocephalus isolepis. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

In the text
Thumbnail: Figure 3 Refer to the following caption and surrounding text. Figure 3

Sclerotized structures of Dactylogyrus cornifrons n. sp. ex Cyprinella venusta. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

In the text
Thumbnail: Figure 4 Refer to the following caption and surrounding text. Figure 4

Sclerotized structures of Dactylogyrus perlus Mueller, 1938 ex Luxilus chrysocephalus isolepis. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; VG – vagina; MCO – male copulatory organ.

In the text
Thumbnail: Figure 5 Refer to the following caption and surrounding text. Figure 5

Sclerotized structures of Dactylogyrus mcallisteri n. sp. (A) and D. atromaculatus Mizelle, 1938 (B) ex Semotilus atromaculatus from Arkansas and Wisconsin, respectively. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

In the text
Thumbnail: Figure 6 Refer to the following caption and surrounding text. Figure 6

Sclerotized structures of Dactylogyrus chieni n. sp. ex Hypentelium nigricans. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; VG – vagina; MCO – male copulatory organ.

In the text
Thumbnail: Figure 7 Refer to the following caption and surrounding text. Figure 7

Sclerotized structures of Dactylogyrus haneki n. sp. ex Hypentelium nigricans. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; VG – vagina; MCO – male copulatory organ.

In the text
Thumbnail: Figure 8 Refer to the following caption and surrounding text. Figure 8

Sclerotized structures of Dactylogyrus eos Hanek, Molnár & Fernando, 1975 ex Chrosomus neogaeus. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; VG – vagina; MCO – male copulatory organ.

In the text
Thumbnail: Figure 9 Refer to the following caption and surrounding text. Figure 9

Sclerotized structures of Dactylogyrus fimbratus n. sp. ex Rhinichthys cataractae. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

In the text
Thumbnail: Figure 10 Refer to the following caption and surrounding text. Figure 10

Sclerotized structures of Dactylogyrus parvicirrus Seamster, 1948 ex Notemigonus crysoleucas. A – anchor; DB – dorsal bar; VB – ventral bar; N – needle; I–VII – hooks; MCO – male copulatory organ.

In the text
Thumbnail: Figure 11 Refer to the following caption and surrounding text. Figure 11

Phylogenetic tree of 38 Dactylogyrus species from Nearctic and Palaearctic cypriniforms resulting from BI analysis. The tree is based on concatenated partial sequences of the 28S rDNA, 18S rDNA, and ITS1 regions. Numbers along branches indicate posterior probabilities and bootstrap values resulting from BI and ML analyses, respectively. Only values >0.70 for BI and >50% for ML are shown. The new species of Dactylogyrus are highlighted in bold.

In the text
Thumbnail: Figure 12 Refer to the following caption and surrounding text. Figure 12

Drawings of the MCOs taken from hologenophores of Dactylogyrus spp. included in subclade A1 of the phylogenetic tree (Fig. 11). Dactylogyrus arcus ex Luxilus chrysocephalus isolepis (Arkansas), D. bifurcatus ex Pimephales notatus (Arkansas), D. bulbus ex Luxilus c. isolepis (Arkansas), D. cloutmani n. sp. ex Luxilus c. isolepis (Arkansas), D. cornifrons n. sp. ex Cyprinella venusta (Mississippi), D. lachneri ex Nocomis biguttatus (Wisconsin), D. ornatus ex Notropis petersoni (Mississippi), D. simplexus ex P. notatus (Arkansas), D. venusti ex C. venusta (Mississippi).

In the text
Thumbnail: Figure 13 Refer to the following caption and surrounding text. Figure 13

Drawings of the MCOs taken from hologenophores of Dactylogyrus spp. included in subclade A2 of the phylogenetic tree (Fig. 11). Dactylogyrus boopsi ex Notropis telescopus (Arkansas), D. confusus ex Clinostomus elongatus (Wisconsin), D. opsopoeodi ex Opsopoeodus emiliae (Mississippi), D. perlus ex Luxilus chrysocephalus isolepis (Arkansas), D. rhinichthius ex Rhinichthys atratulus (Wisconsin).

In the text
Thumbnail: Figure 14 Refer to the following caption and surrounding text. Figure 14

Drawings of the MCOs taken from hologenophores of Dactylogyrus spp. included in subclade A3 of the phylogenetic tree (Fig. 11). Dactylogyrus aduncus n. sp. ex Campostoma spadiceum (Arkansas), D. atromaculatus ex Semotilus atromaculatus (Wisconsin), D. attenuatus ex S. atromaculatus (Wisconsin), D. aviunguis from Nocomis biguttatus (Wisconsin), D. chieni n. sp. ex Hypentelium nigricans (Arkansas), D. chrosomi ex Chrosomus neogaeus (Wisconsin), D. haneki n. sp. ex H. nigricans (Arkansas), D. mcallisteri n. sp. ex S. atromaculatus (Arkansas).

In the text
Thumbnail: Figure 15 Refer to the following caption and surrounding text. Figure 15

Drawings of the MCOs taken from hologenophores of Dactylogyrus spp. included in clade B of the phylogenetic tree (Fig. 11). Dactylogyrus cheloideus ex Rhinichthys atratulus (Wisconsin), D. eos ex Chrosomus neogaeus (Wisconsin), D. fimbratus n. sp. ex Rhinichthys cataractae (New York), D. flagristylus ex Nocomis biguttatus (Wisconsin), D. parvicirrus ex Notemigonus crysoleucas (New York), D. pectenatus ex Pimephales promelas (Wisconsin).

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.